version
PlantPromoterDB promoter information of AT3G21370.1

Summary of Gene (AT3G21370.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G21370  TAIR      NCBI 
Gene model AT3G21370.1  
Description BETA GLUCOSIDASE 19 (BGLU19); FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: seed; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 1 (InterPro:IPR001360), Glycoside hydrolase, family 1, active site (InterPro:IPR018120), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: BGLU18 (BETA GLUCOSIDASE 18); catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT1G52400.1); Has 5737 Blast hits to 5490 proteins in 796 species: Archae - 98; Bacteria - 3105; Metazoa - 607; Fungi - 134; Plants - 850; Viruses - 0; Other Eukaryotes - 943 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 7528579-7527380)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G21370.1                      5'->3' (-)
Promoter sequence












 
AT3G21371.1         
AT3G21380.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence







 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G21370.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA13-7527652-73

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-7527652-73
TSS cloneAclone-7527651-72

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTGTATATATCTATAAATATATAAC-75276737527696-94-117
Y PatchCTCCTTTC-75276587527665-79-86
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGTCACGT-75277127527719-133-140
 AtREG606TGTCACGTABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGATTTGGGCTTTG-75277397527750-160-171
 AtREG421ATTTGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG469 TTTGGGCT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  TTGGGCTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376   TGGGCTTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG559    GGGCTTTG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA8+7528187AT3G21380.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneCclone+7528185AT3G21380.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxTGTCTATATAAAAA+75281477528160AT3G21380.1
Y PatchTCTCTCAT+75281957528202AT3G21380.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGACGTGTGA+75280857528092AT3G21380.1
 AtREG588ACGTGTGAABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.