version
PlantPromoterDB promoter information of AT3G22425.1

Summary of Gene (AT3G22425.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G22425  TAIR      NCBI 
Gene model AT3G22425.1  
Description Encodes imidazoleglycerolphosphate dehydratase.  
#
#

Overview

Focused view (chromosome 3: 7950110-7951309)

Genome position     
from initiation codon
AT3G22425.2         
TSS from cDNA
TSS information
AT3G22425.1                      5'->3' (+)
Promoter sequence









 
AT3G22421.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G22425.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA4+7951064-46

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone+7951055-55
TSS cloneTclone+7951057-53
TSS cloneTclone+7951090-20
TSS cloneCclone+7951099-11

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGACCGGTTAT+79509277950936-183-174
 AtREG552GACCGGTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG503 ACCGGTTA  PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG548  CCGGTTAT PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
REGCTTAACCG+79509677950974-143-136
 AtREG605CTTAACCG PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
REGACCGGTTCGGTTCGGTT+79510077951023-103-87
 AtREG528ACCGGTTC          PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG423 CCGGTTCG         PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG456  CGGTTCGGTTCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451   GGTTCGGTTCGGT  PPDB Motif  PLACE Motif 
 AtREG556    GTTCGGTTCGGTT PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG575      TCGGTTCG    PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.