version
PlantPromoterDB promoter information of AT3G23325.1

Summary of Gene (AT3G23325.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G23325  TAIR      NCBI 
Gene model AT3G23325.1  
Description splicing factor, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: mRNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Splicing factor 3B subunit 5/RDS3 complex subunit 10 (InterPro:IPR009846), Splicing factor 3B, subunit 5 (InterPro:IPR017089); BEST Arabidopsis thaliana protein match is: pre-mRNA splicing factor 10 kDa subunit, putative (TAIR:AT4G14342.1); Has 220 Blast hits to 220 proteins in 118 species: Archae - 0; Bacteria - 0; Metazoa - 90; Fungi - 61; Plants - 31; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 8344808-8346007)

Genome position     
from initiation codon
AT3G23320.1         
TSS from cDNA
TSS information
AT3G23325.1                      5'->3' (+)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G23325.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG2+8345771-37

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone+8345771-37
TSS cloneTclone+8345772-36

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCATATATAAACC+83457378345748-71-60
Y PatchTTCTTCTTCTT+83457748345784-34-24
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCCAAAA+83454778345484-331-324
 AtREG529GCCCAAAA PPDB MotifGCCCA  PLACE Motif 
REGAAAGTCAA+83454898345496-319-312
 AtREG632AAAGTCAA PPDB Motif  PLACE MotifTTGAC 
REGGTCCGGTTC+83456148345622-194-186
 AtREG573GTCCGGTT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG579 TCCGGTTC PPDB MotifAACCG(G/A)  PLACE Motif 
REGACCGGTTC+83456428345649-166-159
 AtREG528ACCGGTTC PPDB MotifAACCG(G/A)  PLACE Motif 
REGAGCCACGTA+83456608345668-148-140
 AtREG450AGCCACGT ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG413 GCCACGTA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
REGATTTGGGCCA+83456908345699-118-109
 AtREG421ATTTGGGC   PPDB MotifGCCCA  PLACE Motif 
 AtREG373 TTTGGGCC  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG420  TTGGGCCA PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGCAAAGCCCAAT+83457108345720-98-88
 AtREG559CAAAGCCC    PPDB MotifGCCCA  PLACE Motif 
 AtREG376 AAAGCCCA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  AAGCCCAA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402   AGCCCAAT PPDB MotifGCCCA  PLACE MotifTGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.