version
PlantPromoterDB promoter information of AT3G24068.1

Summary of Gene (AT3G24068.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G24068  TAIR      NCBI 
Gene model AT3G24068.1  
Description FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Plant self-incompatibility S1 (InterPro:IPR010264); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G24065.1); Has 16 Blast hits to 16 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 8693667-8692468)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G24068.1                      5'->3' (-)
Promoter sequence

 
AT3G24070.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence










 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G24068.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone+8693085AT3G24070.1
TSS clone peakTclone+8693086AT3G24070.1
TSS cloneGclone+8693092AT3G24070.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxTAAATATAAATATA+86930578693070AT3G24070.1
Y PatchTTTCTCTCCC+86931058693114AT3G24070.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCCCATTAAAAGTCAA+86929338692947AT3G24070.1
 AtREG396CCCATTAA        PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG632       AAAGTCAA PPDB Motif  PLACE MotifTTGAC 
REGGTTTGGGCT+86929548692962AT3G24070.1
 AtREG474GTTTGGGC  PPDB MotifGCCCA  PLACE Motif 
 AtREG469 TTTGGGCT PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGGTTTGGGCTTTAGTAGGCCCAACT+86929748692997AT3G24070.1
 AtREG474GTTTGGGC                 PPDB MotifGCCCA  PLACE Motif 
 AtREG469 TTTGGGCT                PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  TTGGGCTT               PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376   TGGGCTTT              PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG365    GGGCTTTA             PPDB MotifGCCCA  PLACE Motif 
 AtREG435            GTAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG358             TAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356              AGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG449               GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE MotifGGGCC, TGGGCY 
 AtREG607                GCCCAACT PPDB MotifGCCCA  PLACE Motif 
REGTTAATGGGC+86930328693040AT3G24070.1
 AtREG396TTAATGGG  PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG357 TAATGGGC PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.