version
PlantPromoterDB promoter information of AT3G26030.1

Summary of Gene (AT3G26030.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G26030  TAIR      NCBI 
Gene model AT3G26030.1  
Description protein phosphatase 2A regulatory subunit isoform B' delta  
#
#

Overview

Focused view (chromosome 3: 9516741-9517940)

Genome position     
from initiation codon
AT3G26020.1         
AT3G26020.2         
AT3G26020.3         
AT3G26020.4         
TSS from cDNA
TSS information
AT3G26030.1                      5'->3' (+)
Promoter sequence

















 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G26030.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA5+9517227-514
TSS peakA2+9517343-398
TSS peakA4+9517637-104

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone+9517261-480
TSS cloneAclone+9517313-428
TSS cloneAclone+9517343-398

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCTCTC+95172319517239-510-502
Y PatchTCCTCTCTTTCT+95172489517259-493-482
Y PatchTCTCTCTCTCTCTTT+95172619517275-480-466
Y PatchTTCTCTCTCTTCTTCTCT+95172959517312-446-429
Y PatchTTCCTTCTTCTTCTTCTTCTTCTTCTTCTTC+95173509517380-391-361
Y PatchCTTTCTTC+95176509517657-91-84
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCGGTTTAG+95171179517125-624-616
 AtREG514TCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG511 CGGTTTAG PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTTGACCC+95174019517408-340-333
 AtREG592TTTGACCC PPDB Motif  PLACE MotifTTGAC, TTGACC 
REGTTCACGCGCTT+95174689517478-273-263
 AtREG631TTCACGCG   Drought PPDB Motif  PLACE Motif 
 AtREG395 TCACGCGC   PPDB MotifACGCGC  PLACE Motif 
 AtREG381  CACGCGCT  PPDB MotifACGCGC  PLACE Motif 
 AtREG492   ACGCGCTT PPDB MotifACGCGC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.