version
PlantPromoterDB promoter information of AT3G26670.3

Summary of Gene (AT3G26670.3)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G26670  TAIR      NCBI 
Gene model AT3G26670.3  
Description FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF803 (InterPro:IPR008521); BEST Arabidopsis thaliana protein match is: permease-related (TAIR:AT3G23870.1); Has 715 Blast hits to 711 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 298; Fungi - 244; Plants - 119; Viruses - 2; Other Eukaryotes - 52 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 9801562-9800363)

Genome position     
from initiation codon
AT3G26670.1         
AT3G26670.2         
TSS from cDNA
TSS information
AT3G26670.3                      5'->3' (-)
Promoter sequence






 
AT3G26680.1         
AT3G26680.2         
AT3G26680.3         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G26670.3

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA8-9801099-537
TSS peakC2-9800639-77

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-9801092-530
TSS cloneAclone-9800910-348

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTCTTCTCTT-98006669800676-104-114
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAATAGCCC-98006929800699-130-137
 AtREG584AATAGCCC PPDB MotifGCCCA  PLACE Motif 
REGAAAAAGCCCAAAA-98011629801174-600-612
 AtREG589AAAAAGCC      PPDB Motif  PLACE Motif 
 AtREG409 AAAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407   AAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG469    AGCCCAAA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG529     GCCCAAAA PPDB MotifGCCCA  PLACE Motif 
REGTTTGACCC-98012509801257-688-695
 AtREG592TTTGACCC PPDB Motif  PLACE MotifTTGAC, TTGACC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakGclone+9801308AT3G26680.1, AT3G26680.2, AT3G26680.3

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.