version
PlantPromoterDB promoter information of AT3G42790.1

Summary of Gene (AT3G42790.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G42790  TAIR      NCBI 
Gene model AT3G42790.1  
Description AL3 encodes a member of the Alfin-Like family of nuclear-localized PhD domain containing homeodomain proteins. Binds to H3K4 di or trimethylated DNA.  
#
#

Overview

Focused view (chromosome 3: 14880618-14879419)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G42790.1                      5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G42790.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG13-14879667-49

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-14879735-117
TSS cloneCclone-14879712-94
TSS cloneCclone-14879707-89
TSS cloneCclone-14879673-55
TSS cloneCclone-14879672-54
TSS cloneCclone-14879671-53
TSS cloneTclone-14879668-50
TSS cloneCclone-14879652-34

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTCTCT-1487965414879661-36-43
Y PatchTTCCCTCT-1487966814879675-50-57
Y PatchCGTCTTCTTC-1487968614879695-68-77
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGACCCGACCCGAACCA-1487979114879807-173-189
 AtREG617TGACCCGA          PPDB Motif  PLACE Motif 
 AtREG390 GACCCGAC         PPDB MotifCCGAC, GGGACCC  PLACE MotifCCGAC 
 AtREG405  ACCCGACC        PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG442   CCCGACCC       PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG375    CCGACCCG      PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG383     CGACCCGA     PPDB Motif  PLACE Motif 
 AtREG597      GACCCGAA    PPDB MotifGGGACCC  PLACE Motif 
 AtREG655         CCGAACCA PPDB Motif  PLACE Motif 
REGATTTGGGCTTTTGGGCTTC-1487982514879843-207-225
 AtREG421ATTTGGGC            PPDB MotifGCCCA  PLACE Motif 
 AtREG469 TTTGGGCTTTTGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  TTGGGCTTTTGGGCTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376   TGGGCTTT         PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG409    GGGCTTTT        PPDB MotifGCCCA  PLACE Motif 
 AtREG529        TTTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG476           TGGGCTTC PPDB MotifGCCCA  PLACE MotifTGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.