version
PlantPromoterDB promoter information of AT3G42950.1

Summary of Gene (AT3G42950.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G42950  TAIR      NCBI 
Gene model AT3G42950.1  
Description glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein; FUNCTIONS IN: polygalacturonase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), Glycoside hydrolase, family 28 (InterPro:IPR000743), Pectin lyase fold (InterPro:IPR012334), Parallel beta-helix repeat (InterPro:IPR006626); BEST Arabidopsis thaliana protein match is: glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein (TAIR:AT1G19170.1); Has 2496 Blast hits to 2489 proteins in 316 species: Archae - 2; Bacteria - 615; Metazoa - 8; Fungi - 925; Plants - 839; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 15014383-15015582)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G42950.1                      5'->3' (+)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G42950.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA13+15015163-220

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone+15015167-216
TSS cloneTclone+15015189-194

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTCTCTC+1501516715015174-216-209
Y PatchCTTTCTCT+1501518415015191-199-192
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCGGTTCGGTTT+1501501415015025-369-358
 AtREG575TCGGTTCG     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG456 CGGTTCGG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451  GGTTCGGT   PPDB Motif  PLACE Motif 
 AtREG556   GTTCGGTT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568    TTCGGTTT PPDB MotifAACCG(G/A)  PLACE Motif 
REGACGGTTTAT+1501503815015046-345-337
 AtREG652ACGGTTTA  PPDB Motif  PLACE Motif 
 AtREG598 CGGTTTAT PPDB MotifAACCG(G/A)  PLACE Motif 
REGTCGGTTCG+1501505615015063-327-320
 AtREG575TCGGTTCG PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTTCCGGTTCA+1501508715015097-296-286
 AtREG644TTTCCGGT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534 TTCCGGTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG579  TCCGGTTC  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG480   CCGGTTCA PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.