version
PlantPromoterDB promoter information of AT3G46580.1

Summary of Gene (AT3G46580.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G46580  TAIR      NCBI 
Gene model AT3G46580.1  
Description Protein containing a putative methyl-CpG-binding domain.Has sequence similarity to human MBD proteins.  
#
#

Overview

Focused view (chromosome 3: 17147397-17148596)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G46580.1                      5'->3' (+)
Promoter sequence














 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G46580.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG2+17148368-29

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+17148342-55

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTTTATATACAC+1714833517148345-62-52
Y PatchCTTTCTCT+1714836017148367-37-30
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCTTAATGGGCCCAAAAGCCCAAAA+1714817317148196-224-201
 AtREG604CTTAATGG                 PPDB Motif  PLACE MotifTTAATGG 
 AtREG396 TTAATGGG                PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG357  TAATGGGC               PPDB MotifGCCCA  PLACE Motif 
 AtREG361   AATGGGCC              PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG391    ATGGGCCC             PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG422     TGGGCCCA            PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG392      GGGCCCAA           PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG373       GGCCCAAA          PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG529        GCCCAAAAGCCCAAAA PPDB MotifGCCCA  PLACE Motif 
 AtREG409            AAAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 AtREG376             AAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407              AAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG469               AGCCCAAA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGACGTGGCT+1714820317148210-194-187
 AtREG450ACGTGGCTABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.