version
PlantPromoterDB promoter information of AT3G47960

Summary of Gene (AT3G47960)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G47960  TAIR      NCBI 
Gene model AT3G47960  
Description proton-dependent oligopeptide transport (POT) family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: oligopeptide transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TGF-beta receptor, type I/II extracellular region (InterPro:IPR000109), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: proton-dependent oligopeptide transport (POT) family protein (TAIR:AT5G62680.1); Has 2355 Blast hits to 2218 proteins in 361 species: Archae - 0; Bacteria - 385; Metazoa - 535; Fungi - 246; Plants - 1124; Viruses - 0; Other Eukaryotes - 65 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 17701681-17700482)

Genome position     
from initiation codon
AT3G47960.1         
TSS from cDNA
TSS information
AT3G47960                        5'->3' (-)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G47960

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA8-17700762-81

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-17700769-88
TSS cloneAclone-17700762-81
TSS cloneTclone-17700755-74
TSS cloneCclone-17700683-2

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCCACTATATATAAT-1770079017700803-109-122
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCAGCCCA-1770095917700966-278-285
 AtREG609TCAGCCCA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGAAATGGGCCTAC-1770098217700993-301-312
 AtREG386AAATGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG361 AATGGGCC    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354  ATGGGCCT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG358   TGGGCCTA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG435    GGGCCTAC PPDB MotifGCCCA  PLACE MotifGGGCC 
REGTTGACTTT-1770102317701030-342-349
 AtREG632TTGACTTT PPDB Motif  PLACE MotifTTGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.