version
PlantPromoterDB promoter information of AT3G48930.1

Summary of Gene (AT3G48930.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G48930  TAIR      NCBI 
Gene model AT3G48930.1  
Description embryo defective 1080 (EMB1080); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: embryonic development ending in seed dormancy, translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, cell wall, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Ribosomal protein S17 (InterPro:IPR000266); BEST Arabidopsis thaliana protein match is: RPS11-BETA (RIBOSOMAL PROTEIN S11-BETA); structural constituent of ribosome (TAIR:AT5G23740.1); Has 956 Blast hits to 954 proteins in 334 species: Archae - 160; Bacteria - 168; Metazoa - 241; Fungi - 98; Plants - 94; Viruses - 0; Other Eukaryotes - 195 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 18143189-18141990)

Genome position     
from initiation codon
AT3G48940.1         
TSS from cDNA
TSS information
AT3G48930.1                      5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G48930.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA123-18142259-70

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-18142272-83
TSS cloneTclone-18142266-77
TSS cloneAclone-18142262-73
TSS cloneGclone-18142261-72
TSS cloneAclone-18142259-70
TSS cloneAclone-18142258-69
TSS cloneTclone-18142257-68
TSS cloneTclone-18142253-64

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCTTATATAAAGA-1814229018142301-101-112
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCTAAGGCCCGTAATTAAAGGCCCAATAA-1814233918142366-150-177
 AtREG577CTAAGGCC                     PPDB Motif  PLACE Motif 
 AtREG351 TAAGGCCC                    PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG429   AGGCCCGT                  PPDB MotifACGGGC  PLACE MotifGGGCC 
 AtREG646        CGTAATTA            ABA PPDB Motif  PLACE Motif 
 AtREG639             TTAAAGGC        PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG467              TAAAGGCC       PPDB Motif  PLACE Motif 
 AtREG359               AAAGGCCC      PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353                AAGGCCCA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356                 AGGCCCAA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352                  GGCCCAAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG355                   GCCCAATA  PPDB MotifGCCCA  PLACE Motif 
 AtREG417                    CCCAATAA PPDB MotifGCCCA  PLACE Motif 
REGCTTGGGCCTAAA-1814236918142380-180-191
 AtREG505CTTGGGCC     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356 TTGGGCCT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG358  TGGGCCTA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG360   GGGCCTAA  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG430    GGCCTAAA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.