version
PlantPromoterDB promoter information of AT3G49080.1

Summary of Gene (AT3G49080.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G49080  TAIR      NCBI 
Gene model AT3G49080.1  
Description ribosomal protein S9 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome, intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S9 (InterPro:IPR000754), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721); BEST Arabidopsis thaliana protein match is: RPS9 (RIBOSOMAL PROTEIN S9); structural constituent of ribosome (TAIR:AT1G74970.1); Has 5624 Blast hits to 5609 proteins in 1600 species: Archae - 138; Bacteria - 2917; Metazoa - 148; Fungi - 89; Plants - 121; Viruses - 18; Other Eukaryotes - 2193 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 18197657-18196458)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G49080.1                      5'->3' (-)
Promoter sequence









 
AT3G49100.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G49080.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG4-18196727-70

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-18196726-69
TSS cloneAclone-18196716-59

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTTCTTC-1819671818196726-61-69
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAACCGAACCGGT-1819676718196779-110-122
 AtREG568AAACCGAA      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG556 AACCGAAC     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451  ACCGAACC    PPDB Motif  PLACE Motif 
 AtREG456   CCGAACCG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG423    CGAACCGG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG528     GAACCGGT PPDB MotifAACCG(G/A)  PLACE Motif 
REGCAAACCGGAATAAACCGACT-1819678118196800-124-143
 AtREG496CAAACCGG             PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521 AAACCGGA            PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534  AACCGGAA           PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG598         ATAAACCG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514          TAAACCGA   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG641            AACCGACT PPDB MotifAACCG(G/A), CCGAC  PLACE MotifCCGAC, RCCGAC 
REGGGCTTTTT-1819684318196850-186-193
 AtREG589GGCTTTTT PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakCclone+18196849AT3G49100.1
TSS clone peakGclone+18196875AT3G49100.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.