version
PlantPromoterDB promoter information of AT3G49400.1

Summary of Gene (AT3G49400.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G49400  TAIR      NCBI 
Gene model AT3G49400.1  
Description transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell, embryo, flower, cultured cell; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); Has 724 Blast hits to 645 proteins in 140 species: Archae - 0; Bacteria - 177; Metazoa - 195; Fungi - 136; Plants - 78; Viruses - 0; Other Eukaryotes - 138 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 18325373-18324174)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G49400.1                      5'->3' (-)
Promoter sequence








 
AT3G49410.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G49400.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG2-18324530-157

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-18324482-109

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATTTGGGCTTAGCCCATCA-1832458218324600-209-227
 AtREG421ATTTGGGC            PPDB MotifGCCCA  PLACE Motif 
 AtREG469 TTTGGGCT           PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  TTGGGCTT          PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG426   TGGGCTTA         PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG634    GGGCTTAG        PPDB MotifGCCCA  PLACE Motif 
 AtREG571        TTAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG581         TAGCCCAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG635           GCCCATCA PPDB MotifGCCCA  PLACE Motif 
REGATAAAGCC-1832464718324654-274-281
 AtREG601ATAAAGCC PPDB Motif  PLACE Motif 
REGAAAACGACATCG-1832467518324686-302-313
 AtREG520AAAACGAC     PPDB Motif  PLACE Motif 
 AtREG569 AAACGACA    PPDB Motif  PLACE Motif 
 AtREG630    CGACATCG PPDB Motif  PLACE Motif 
REGATTTGGGCCTATT-1832469618324708-323-335
 AtREG421ATTTGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG373 TTTGGGCC     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356  TTGGGCCT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG358   TGGGCCTA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG362    GGGCCTAT  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG424     GGCCTATT PPDB Motif  PLACE Motif 
REGCGACATCG-1832475418324761-381-388
 AtREG630CGACATCG PPDB Motif  PLACE Motif 
REGTTCGGTTT-1832476418324771-391-398
 AtREG568TTCGGTTT PPDB MotifAACCG(G/A)  PLACE Motif 
REGACCGGAAA-1832479718324804-424-431
 AtREG644ACCGGAAA PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakGclone+18324746AT3G49410.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.