PlantPromoterDB promoter information of AT3G53440.1

Summary of Gene (AT3G53440.1)

Organism	Arabidopsis thaliana
Chromosome	3
Locus	AT3G53440 TAIR NCBI
Gene model	AT3G53440.1
Description	DNA binding; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), MYB-like (InterPro:IPR017877); Has 5013 Blast hits to 2696 proteins in 201 species: Archae - 0; Bacteria - 63; Metazoa - 2538; Fungi - 339; Plants - 161; Viruses - 23; Other Eukaryotes - 1889 (source: NCBI BLink).

#

Overview

Focused view (chromosome 3: 19809936-19811135)

`Genome position from initiation codon` `AT3G53440.2 TSS from cDNA TSS information AT3G53440.1 5'->3' (+) Promoter sequence AT3G53430.1 TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G53440.1

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone peak A clone + 19810901 -35

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone peak	`A`	clone	+	19810901	-35

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG None None None

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	None	None	None

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

TSS peak A 18 - 19810468 AT3G53430.1

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
TSS peak	`A`	18	-	19810468	AT3G53430.1

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

TSS clone C clone - 19810470 AT3G53430.1

TSS clone T clone - 19810469 AT3G53430.1

TSS clone A clone - 19810468 AT3G53430.1

TSS clone A clone - 19810467 AT3G53430.1

TSS clone A clone - 19810460 AT3G53430.1

TSS clone T clone - 19810459 AT3G53430.1

TSS clone C clone - 19810448 AT3G53430.1

TSS clone T clone - 19810437 AT3G53430.1

TSS clone A clone - 19810419 AT3G53430.1

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
TSS clone	`C`	clone	-	19810470	AT3G53430.1
TSS clone	`T`	clone	-	19810469	AT3G53430.1
TSS clone	`A`	clone	-	19810468	AT3G53430.1
TSS clone	`A`	clone	-	19810467	AT3G53430.1
TSS clone	`A`	clone	-	19810460	AT3G53430.1
TSS clone	`T`	clone	-	19810459	AT3G53430.1
TSS clone	`C`	clone	-	19810448	AT3G53430.1
TSS clone	`T`	clone	-	19810437	AT3G53430.1
TSS clone	`A`	clone	-	19810419	AT3G53430.1

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG CTAAGCCCATATAATATTGGGTTGGGCCGTT - 19810562 19810592 AT3G53430.1

AtREG634 CTAAGCCC                        PPDB Motif GCCCA PLACE Motif

AtREG426 TAAGCCCA                       PPDB Motif GCCCA PLACE Motif TGGGCY

AtREG378   AAGCCCAT                      PPDB Motif GCCCA PLACE Motif TGGGCY

AtREG477    AGCCCATA                     PPDB Motif GCCCA PLACE Motif TGGGCY

AtREG432     GCCCATAT                    PPDB Motif GCCCA PLACE Motif

AtREG620      CCCATATA                   PPDB Motif GCCCA PLACE Motif

AtREG509              ATATTGGG           PPDB Motif PLACE Motif

AtREG449                     GTTGGGCC    PPDB Motif GCCCA, CCAACGG PLACE Motif GGGCC, TGGGCY

AtREG414                      TTGGGCCG   PPDB Motif GCCCA PLACE Motif GGGCC, TGGGCY

AtREG368                       TGGGCCGT PPDB Motif GCCCA PLACE Motif GGGCC, TGGGCY

AtREG377                        GGGCCGTT PPDB Motif GCCCA, AAACG(C/G) PLACE Motif GGGCC

REG ACGGTTTAA - 19810690 19810698 AT3G53430.1

AtREG652 ACGGTTTA PPDB Motif PLACE Motif

AtREG473 CGGTTTAA PPDB Motif AACCG(G/A) PLACE Motif