version
PlantPromoterDB promoter information of AT3G53750.1

Summary of Gene (AT3G53750.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G53750  TAIR      NCBI 
Gene model AT3G53750.1  
Description Member of the Actin gene family. Expressed in mature pollen.  
#
#

Overview

Focused view (chromosome 3: 19914924-19916123)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G53750.1                      5'->3' (+)
Promoter sequence













 
AT3G53740.1         
AT3G53740.2         
AT3G53740.3         
AT3G53740.4         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence













 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G53750.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA8+19915321-603

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone+19915318-606
TSS cloneTclone+19915322-602

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCCTTC+1991535419915361-570-563
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTTTGGGCTTTTATTGGGCCTTAT+1991505519915078-869-846
 AtREG474GTTTGGGC                 PPDB MotifGCCCA  PLACE Motif 
 AtREG469 TTTGGGCT                PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  TTGGGCTT               PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376   TGGGCTTT              PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG409    GGGCTTTT             PPDB MotifGCCCA  PLACE Motif 
 AtREG549     GGCTTTTA            PPDB Motif  PLACE Motif 
 AtREG417          TTATTGGG       PPDB MotifGCCCA  PLACE Motif 
 AtREG355           TATTGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG352            ATTGGGCC     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356             TTGGGCCT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG353              TGGGCCTT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG351               GGGCCTTA  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG425                GGCCTTAT PPDB MotifAACCG(G/A)  PLACE Motif 
REGCTTAACCG+1991516419915171-760-753
 AtREG605CTTAACCG PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
REGCGTCATTT+1991521719915224-707-700
 AtREG657CGTCATTT PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG8-19914992AT3G53740.1, AT3G53740.2, AT3G53740.3, AT3G53740.4
TSS peakG8-19914977AT3G53740.1, AT3G53740.2, AT3G53740.3, AT3G53740.4

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone-19914992AT3G53740.1, AT3G53740.2, AT3G53740.3, AT3G53740.4
TSS cloneTclone-19914991AT3G53740.1, AT3G53740.2, AT3G53740.3, AT3G53740.4
TSS cloneCclone-19914989AT3G53740.1, AT3G53740.2, AT3G53740.3, AT3G53740.4
TSS cloneTclone-19914988AT3G53740.1, AT3G53740.2, AT3G53740.3, AT3G53740.4
TSS cloneTclone-19914980AT3G53740.1, AT3G53740.2, AT3G53740.3, AT3G53740.4

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxGTATATATACA-1991501419915024AT3G53740.1, AT3G53740.2, AT3G53740.3, AT3G53740.4
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGATAAGGCCCAATAAAAGCCCAAAC-1991505519915078AT3G53740.1, AT3G53740.2, AT3G53740.3, AT3G53740.4
 AtREG425ATAAGGCC                 PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG351 TAAGGCCC                PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353  AAGGCCCA               PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356   AGGCCCAA              PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352    GGCCCAAT             PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG355     GCCCAATA            PPDB MotifGCCCA  PLACE Motif 
 AtREG417      CCCAATAA           PPDB MotifGCCCA  PLACE Motif 
 AtREG549           TAAAAGCC      PPDB Motif  PLACE Motif 
 AtREG409            AAAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 AtREG376             AAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407              AAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG469               AGCCCAAA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG474                GCCCAAAC PPDB MotifGCCCA  PLACE Motif 
REGCGGTTAAG-1991516419915171AT3G53740.1, AT3G53740.2, AT3G53740.3, AT3G53740.4
 AtREG605CGGTTAAG PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
REGAAATGACG-1991521719915224AT3G53740.1, AT3G53740.2, AT3G53740.3, AT3G53740.4
 AtREG657AAATGACG PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.