version
PlantPromoterDB promoter information of AT3G56120.1

Summary of Gene (AT3G56120.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G56120  TAIR      NCBI 
Gene model AT3G56120.1  
Description Met-10+ like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function Met10 (InterPro:IPR003402); BEST Arabidopsis thaliana protein match is: Met-10+ like family protein (TAIR:AT4G27340.1); Has 933 Blast hits to 801 proteins in 255 species: Archae - 252; Bacteria - 75; Metazoa - 244; Fungi - 94; Plants - 62; Viruses - 0; Other Eukaryotes - 206 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 20822243-20823442)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G56120.1                      5'->3' (+)
Promoter sequence






 
AT3G56110.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence





 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G56120.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA4+20823141-102

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTTCTTCTTCC+2082316720823179-76-64
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGGCGCGTGA+2082286320822872-380-371
 AtREG538CGGCGCGT   PPDB MotifACGCGC  PLACE Motif 
 AtREG486 GGCGCGTG  PPDB MotifACGCGC  PLACE Motif 
 AtREG395  GCGCGTGA PPDB MotifACGCGC  PLACE Motif 
REGGGGCCTGA+2082298320822990-260-253
 AtREG374GGGCCTGA PPDB MotifGCCCA  PLACE MotifGGGCC 
REGTTAAACCGGCCCAAAA+2082300620823021-237-222
 AtREG473TTAAACCG         PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGG        PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG457     CCGGCCCA   CK PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG414      CGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG373       GGCCCAAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG529        GCCCAAAA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA5-20822972AT3G56110.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone-20822947AT3G56110.1
TSS cloneAclone-20822946AT3G56110.1
TSS cloneGclone-20822940AT3G56110.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTTTTGGGCCG-2082301220823021AT3G56110.1
 AtREG529TTTTGGGC   PPDB MotifGCCCA  PLACE Motif 
 AtREG373 TTTGGGCC  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG414  TTGGGCCG PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGCGTGGCGT-2082314520823152AT3G56110.1
 AtREG508CGTGGCGT PPDB Motif  PLACE MotifGCCAC 
REGCTAACGGTGTCGTTTT-2082322320823238AT3G56110.1
 AtREG603CTAACGGT         PPDB Motif  PLACE MotifYAACKG, CNGTTR 
 AtREG599     GGTGTCGT    PPDB Motif  PLACE Motif 
 AtREG527      GTGTCGTT  DREB1Aox PPDB Motif  PLACE Motif 
 AtREG569       TGTCGTTT  PPDB Motif  PLACE Motif 
 AtREG520        GTCGTTTT PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.