version
PlantPromoterDB promoter information of AT3G56460.1

Summary of Gene (AT3G56460.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G56460  TAIR      NCBI 
Gene model AT3G56460.1  
Description oxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, zinc ion binding, catalytic activity; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Quinone oxidoreductase/zeta-crystallin, conserved site (InterPro:IPR002364), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: oxidoreductase, zinc-binding dehydrogenase family protein (TAIR:AT4G21580.1); Has 27533 Blast hits to 27426 proteins in 1649 species: Archae - 279; Bacteria - 14496; Metazoa - 1760; Fungi - 2501; Plants - 878; Viruses - 3; Other Eukaryotes - 7616 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 20935425-20934226)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G56460.1                      5'->3' (-)
Promoter sequence







 
AT3G56470.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G56460.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA8-20934487-62

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-20934496-71
TSS cloneGclone-20934495-70
TSS cloneAclone-20934487-62
TSS cloneAclone-20934480-55
TSS cloneGclone-20934479-54

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAAACGGCGTCGT-2093454320934555-118-130
 AtREG613TAAACGGC      PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG524 AAACGGCG     PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG497  AACGGCGT    PPDB MotifAAACG(C/G), CCAACGG  PLACE Motif 
 AtREG540   ACGGCGTC   PPDB Motif  PLACE Motif 
 AtREG537     GGCGTCGT PPDB Motif  PLACE Motif 
REGTAATTACG-2093456220934569-137-144
 AtREG646TAATTACGABA PPDB Motif  PLACE Motif 
REGGACCGGTTCGGTTT-2093460220934615-177-190
 AtREG552GACCGGTT       PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG528 ACCGGTTC      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG423  CCGGTTCG     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG456   CGGTTCGG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451    GGTTCGGT   PPDB Motif  PLACE Motif 
 AtREG556     GTTCGGTT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568      TTCGGTTT PPDB MotifAACCG(G/A)  PLACE Motif 
REGATCCAACGG-2093468920934697-264-272
 AtREG586ATCCAACG  PPDB MotifCCAACGG  PLACE Motif 
 AtREG554 TCCAACGG PPDB MotifCCAACGG  PLACE MotifYAACKG, CNGTTR 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.