version
PlantPromoterDB promoter information of AT3G56860.1

Summary of Gene (AT3G56860.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G56860  TAIR      NCBI 
Gene model AT3G56860.1  
Description encodes a nuclear protein that binds to RNA with a specificity for oligouridylates in vitro. Along with UBP1 and UBA1a, it may act as a component of a complex recognizing U-rich sequences in plant 3'-UTRs and contributing to the stabilization of mRNAs in the nucleus.  
#
#

Overview

Focused view (chromosome 3: 21053144-21051945)

Genome position     
from initiation codon
AT3G56860.2         
AT3G56860.3         
TSS from cDNA
TSS information
AT3G56860.1                      5'->3' (-)
Promoter sequence









 
AT3G56870.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G56860.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA13-21052223-79

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-21052237-93
TSS cloneAclone-21052223-79
TSS cloneAclone-21052222-78
TSS cloneAclone-21052195-51
TSS cloneAclone-21052187-43
TSS cloneAclone-21052147-3

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGGGGTAA-2105229521052302-151-158
 AtREG642AGGGGTAA PPDB MotifACCCCT  PLACE Motif 
REGTTAATGGGCTTAT-2105231821052330-174-186
 AtREG396TTAATGGG      PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG357 TAATGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG372  AATGGGCT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378   ATGGGCTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG426    TGGGCTTA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG462     GGGCTTAT PPDB MotifGCCCA  PLACE Motif 
REGTTAAAGCCCAATAA-2105233421052347-190-203
 AtREG545TTAAAGCC       PPDB Motif  PLACE Motif 
 AtREG365 TAAAGCCC      PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407   AAGCCCAA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402    AGCCCAAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG355     GCCCAATA  PPDB MotifGCCCA  PLACE Motif 
 AtREG417      CCCAATAA PPDB MotifGCCCA  PLACE Motif 
REGTAAATGGG-2105235721052364-213-220
 AtREG443TAAATGGG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.