version
PlantPromoterDB promoter information of AT3G57930.1

Summary of Gene (AT3G57930.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G57930  TAIR      NCBI 
Gene model AT3G57930.1  
Description unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G42190.1); Has 1665 Blast hits to 1254 proteins in 137 species: Archae - 0; Bacteria - 32; Metazoa - 833; Fungi - 105; Plants - 87; Viruses - 30; Other Eukaryotes - 578 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 21448675-21447476)

Genome position     
from initiation codon
AT3G57930.2         
TSS from cDNA
TSS information
AT3G57930.1                      5'->3' (-)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G57930.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA4-21448649-974
TSS peakA4-21448620-945

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-21448619-944

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGCGCGTG-2144875021448757-1075-1082
 AtREG486GGCGCGTG PPDB MotifACGCGC  PLACE Motif 
REGCACGCGCC-2144876621448773-1091-1098
 AtREG486CACGCGCC PPDB MotifACGCGC  PLACE Motif 
REGAACCGAACC-2144880621448814-1131-1139
 AtREG556AACCGAAC  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451 ACCGAACC PPDB Motif  PLACE Motif 
REGCTAATGGGCCAAAGCCCAAAC-2144889621448916-1221-1241
 AtREG558CTAATGGG              PPDB MotifGCCCA  PLACE Motif 
 AtREG357 TAATGGGC             PPDB MotifGCCCA  PLACE Motif 
 AtREG361  AATGGGCC            PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG490   ATGGGCCA           PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG484    TGGGCCAA          PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG559         CAAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 AtREG376          AAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407           AAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG469            AGCCCAAA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG474             GCCCAAAC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.