version
PlantPromoterDB promoter information of AT3G57940.1

Summary of Gene (AT3G57940.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G57940  TAIR      NCBI 
Gene model AT3G57940.1  
Description unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Region of unknown function DUF1726 (InterPro:IPR013562), Protein of unknown function DUF699, ATPase putative (InterPro:IPR007807); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G10490.1); Has 915 Blast hits to 873 proteins in 391 species: Archae - 82; Bacteria - 412; Metazoa - 163; Fungi - 92; Plants - 21; Viruses - 3; Other Eukaryotes - 142 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 21448560-21449759)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G57940.1                      5'->3' (+)
Promoter sequence










 
AT3G57930.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence










 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G57940.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+21449298-262

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTCTTCTT+2144914521449153-415-407
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTTTGGGCTTTGGCCCATTAG+2144889621448916-664-644
 AtREG474GTTTGGGC              PPDB MotifGCCCA  PLACE Motif 
 AtREG469 TTTGGGCT             PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  TTGGGCTT            PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376   TGGGCTTT           PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG559    GGGCTTTG          PPDB MotifGCCCA  PLACE Motif 
 AtREG484         TTGGCCCA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG490          TGGCCCAT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG361           GGCCCATT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG357            GCCCATTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG558             CCCATTAG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA4-21448649AT3G57930.1, AT3G57930.2
TSS peakA4-21448620AT3G57930.1, AT3G57930.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone-21448619AT3G57930.1, AT3G57930.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGGCGCGTG-2144875021448757AT3G57930.1, AT3G57930.2
 AtREG486GGCGCGTG PPDB MotifACGCGC  PLACE Motif 
REGCACGCGCC-2144876621448773AT3G57930.1, AT3G57930.2
 AtREG486CACGCGCC PPDB MotifACGCGC  PLACE Motif 
REGAACCGAACC-2144880621448814AT3G57930.1, AT3G57930.2
 AtREG556AACCGAAC  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451 ACCGAACC PPDB Motif  PLACE Motif 
REGCTAATGGGCCAAAGCCCAAAC-2144889621448916AT3G57930.1, AT3G57930.2
 AtREG558CTAATGGG              PPDB MotifGCCCA  PLACE Motif 
 AtREG357 TAATGGGC             PPDB MotifGCCCA  PLACE Motif 
 AtREG361  AATGGGCC            PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG490   ATGGGCCA           PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG484    TGGGCCAA          PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG559         CAAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 AtREG376          AAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407           AAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG469            AGCCCAAA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG474             GCCCAAAC PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.