version
PlantPromoterDB promoter information of AT3G60900.1

Summary of Gene (AT3G60900.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G60900  TAIR      NCBI 
Gene model AT3G60900.1  
Description FLA10; LOCATED IN: anchored to plasma membrane, plasma membrane, anchored to membrane; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: FAS1 domain (InterPro:IPR000782); BEST Arabidopsis thaliana protein match is: FLA8 (FASCICLIN-LIKE ARABINOGALACTAN PROTEIN 8) (TAIR:AT2G45470.1); Has 12081 Blast hits to 6122 proteins in 671 species: Archae - 102; Bacteria - 3569; Metazoa - 1134; Fungi - 757; Plants - 1832; Viruses - 697; Other Eukaryotes - 3990 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 22501841-22500642)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G60900.1                      5'->3' (-)
Promoter sequence








 
AT3G60910.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G60900.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA2-22500883-42

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone-22500882-41
TSS cloneCclone-22500876-35

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTTCTCTTCTCC-2250087022500882-29-41
Y PatchCTCTCTTT-2250089222500899-51-58
Y PatchCCTCTTCTTCTTCTT-2250091322500927-72-86
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCACGTGTT-2250097822500985-137-144
 AtREG590CACGTGTTABA, JA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
REGGGCTTTTT-2250100122501008-160-167
 AtREG589GGCTTTTT PPDB Motif  PLACE Motif 
REGCAAAGCCCAC-2250102622501035-185-194
 AtREG559CAAAGCCC   PPDB MotifGCCCA  PLACE Motif 
 AtREG376 AAAGCCCA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG518  AAGCCCAC PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGCGGTTCGGTTCGGTT-2250107222501086-231-245
 AtREG456CGGTTCGGTTCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451 GGTTCGGTTCGGT  PPDB Motif  PLACE Motif 
 AtREG556  GTTCGGTTCGGTT PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG575    TCGGTTCG    PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone+22501698AT3G60910.1
TSS clone peakGclone+22501712AT3G60910.1
TSS cloneAclone+22501721AT3G60910.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.