version
PlantPromoterDB promoter information of AT3G61580

Summary of Gene (AT3G61580)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G61580  TAIR      NCBI 
Gene model AT3G61580  
Description delta-8 sphingolipid desaturase (SLD1); FUNCTIONS IN: oxidoreductase activity, sphingolipid delta-4 desaturase activity; INVOLVED IN: lipid metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Fatty acid desaturase, type 1 (InterPro:IPR005804), Cytochrome b5 (InterPro:IPR001199), Fatty acid/sphingolipid desaturase (InterPro:IPR012171); BEST Arabidopsis thaliana protein match is: delta-8 sphingolipid desaturase, putative (TAIR:AT2G46210.1); Has 3797 Blast hits to 3723 proteins in 598 species: Archae - 1; Bacteria - 564; Metazoa - 826; Fungi - 1045; Plants - 622; Viruses - 2; Other Eukaryotes - 737 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 22785253-22786452)

Genome position     
from initiation codon
AT3G61580.1         
TSS from cDNA
TSS information
AT3G61580                        5'->3' (+)
Promoter sequence



 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G61580

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA60+22786065-188

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+22786048-205
TSS cloneAclone+22786052-201
TSS cloneTclone+22786064-189
TSS cloneAclone+22786065-188
TSS cloneAclone+22786066-187
TSS cloneGclone+22786067-186
TSS cloneCclone+22786068-185
TSS cloneGclone+22786070-183
TSS cloneGclone+22786072-181

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCCAATAA+2278585422785862-399-391
 AtREG355GCCCAATA  PPDB MotifGCCCA  PLACE Motif 
 AtREG417 CCCAATAA PPDB MotifGCCCA  PLACE Motif 
REGCCCAATAT+2278591122785918-342-335
 AtREG509CCCAATAT PPDB Motif  PLACE Motif 
REGCACACGTGA+2278592822785936-325-317
 AtREG460CACACGTG ABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG628 ACACGTGADREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
REGAGCCACGTA+2278596122785969-292-284
 AtREG450AGCCACGT ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG413 GCCACGTA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.