version
PlantPromoterDB promoter information of AT3G62120.2

Summary of Gene (AT3G62120.2)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G62120  TAIR      NCBI 
Gene model AT3G62120.2  
Description tRNA synthetase class II (G, H, P and S) family protein; FUNCTIONS IN: proline-tRNA ligase activity, aminoacyl-tRNA ligase activity, nucleotide binding, ATP binding; INVOLVED IN: prolyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class II (G, H, P and S), conserved region (InterPro:IPR002314), Prolyl-tRNA synthetase, class IIa, prokaryotic-type (InterPro:IPR004499), Prolyl-tRNA synthetase, class II, C-terminal (InterPro:IPR016061), Anticodon-binding (InterPro:IPR004154), Prolyl-tRNA synthetase, class II (InterPro:IPR017449), Prolyl-tRNA synthetase, class IIa, conserved region (InterPro:IPR002316), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195); BEST Arabidopsis thaliana protein match is: OVA6 (OVULE ABORTION 6); ATP binding / aminoacyl-tRNA ligase/ nucleotide binding / proline-tRNA ligase (TAIR:AT5G52520.1); Has 5872 Blast hits to 5731 proteins in 1483 species: Archae - 181; Bacteria - 3502; Metazoa - 187; Fungi - 122; Plants - 56; Viruses - 0; Other Eukaryotes - 1824 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 23004849-23003650)

Genome position     
from initiation codon
AT3G62120.1         
TSS from cDNA
TSS information
AT3G62120.2                      5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G62120.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA26-23004320-471

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-23004319-470
TSS cloneAclone-23004300-451
TSS cloneTclone-23004273-424
TSS cloneTclone-23004265-416
TSS cloneAclone-23004254-405
TSS cloneTclone-23004253-404
TSS cloneGclone-23004248-399
TSS cloneCclone-23004247-398

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxGTATATAAT-2300434623004354-497-505
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCTTATTGGGCTTGGCCCATG-2300440323004422-554-573
 AtREG611CTTATTGG             PPDB Motif  PLACE Motif 
 AtREG417 TTATTGGG            PPDB MotifGCCCA  PLACE Motif 
 AtREG355  TATTGGGC           PPDB MotifGCCCA  PLACE Motif 
 AtREG402   ATTGGGCT          PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407    TTGGGCTT         PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG525     TGGGCTTG        PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG484          TTGGCCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG490           TGGCCCAT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG504            GGCCCATG PPDB MotifGCCCA, CCATGG  PLACE MotifGGGCC, TGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.