version
PlantPromoterDB promoter information of AT3G62360.1

Summary of Gene (AT3G62360.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G62360  TAIR      NCBI 
Gene model AT3G62360.1  
Description carbohydrate binding; FUNCTIONS IN: carbohydrate binding; LOCATED IN: endoplasmic reticulum, plasma membrane, plant-type cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Carbohydrate-binding-like fold (InterPro:IPR013784), Collagen-binding surface protein Cna-like, B region (InterPro:IPR008454); Has 234 Blast hits to 193 proteins in 70 species: Archae - 4; Bacteria - 76; Metazoa - 122; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 23081455-23080256)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G62360.1                      5'->3' (-)
Promoter sequence














 
AT3G62370.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence














 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G62360.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG8-23080560-105

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAGTGGGCTTTATAAAGCCCATTAAGCCCTA-2308061523080645-160-190
 AtREG532TAGTGGGC                        PPDB MotifGCCCA  PLACE Motif 
 AtREG510 AGTGGGCT                       PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG518  GTGGGCTT                      PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG365    GGGCTTTATAAAGCCC            PPDB MotifGCCCA  PLACE Motif 
 AtREG601     GGCTTTATAAAGCC             PPDB Motif  PLACE Motif 
 AtREG376   TGGGCTTT  AAAGCCCA           PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378              AAGCCCAT          PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372               AGCCCATT         PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG357                GCCCATTA        PPDB MotifGCCCA  PLACE Motif 
 AtREG396                 CCCATTAA       PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG604                  CCATTAAG      PPDB Motif  PLACE MotifTTAATGG 
 AtREG651                       AAGCCCTA PPDB Motif  PLACE Motif 
REGACCGGAAA-2308076923080776-314-321
 AtREG644ACCGGAAA PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA4+23080759AT3G62370.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone+23080759AT3G62370.1
TSS cloneGclone+23080775AT3G62370.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTAGGGCTTAATGGGCTTTATAAAGCCCACTA+2308061523080645AT3G62370.1
 AtREG651TAGGGCTT                        PPDB Motif  PLACE Motif 
 AtREG604     CTTAATGG                   PPDB Motif  PLACE MotifTTAATGG 
 AtREG396      TTAATGGG                  PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG357       TAATGGGC                 PPDB MotifGCCCA  PLACE Motif 
 AtREG372        AATGGGCT                PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378         ATGGGCTT               PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG365           GGGCTTTATAAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 AtREG601            GGCTTTATAAAGCC      PPDB Motif  PLACE Motif 
 AtREG376          TGGGCTTT  AAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG518                     AAGCCCAC   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG510                      AGCCCACT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG532                       GCCCACTA PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.