version
PlantPromoterDB promoter information of AT3G62810.1

Summary of Gene (AT3G62810.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G62810  TAIR      NCBI 
Gene model AT3G62810.1  
Description complex 1 family protein / LVR family protein; FUNCTIONS IN: catalytic activity; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Complex 1 LYR protein (InterPro:IPR008011); Has 68 Blast hits to 68 proteins in 33 species: Archae - 0; Bacteria - 0; Metazoa - 22; Fungi - 22; Plants - 17; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 23226763-23227962)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G62810.1                      5'->3' (+)
Promoter sequence










 
AT3G62800.1         
AT3G62800.2         
AT3G62800.3         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence










 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G62810.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA15+23227714-49

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone+23227713-50
TSS cloneGclone+23227720-43
TSS cloneGclone+23227721-42

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTAATGGGCCAAAATTGGGCTTAT+2322761723227640-146-123
 AtREG396TTAATGGG                 PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG357 TAATGGGC                PPDB MotifGCCCA  PLACE Motif 
 AtREG361  AATGGGCC               PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG490   ATGGGCCA              PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG484    TGGGCCAA             PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG418            AATTGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG402             ATTGGGCT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407              TTGGGCTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG426               TGGGCTTA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG462                GGGCTTAT PPDB MotifGCCCA  PLACE Motif 
REGTAAAGGCCCAATG+2322765323227665-110-98
 AtREG467TAAAGGCC      PPDB Motif  PLACE Motif 
 AtREG359 AAAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353  AAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356   AGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352    GGCCCAAT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG461     GCCCAATG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA8-23227531AT3G62800.1, AT3G62800.2, AT3G62800.3

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneCclone-23227505AT3G62800.1, AT3G62800.2, AT3G62800.3

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGATAAGCCCAATTTTGGCCCATTAA-2322761723227640AT3G62800.1, AT3G62800.2, AT3G62800.3
 AtREG462ATAAGCCC                 PPDB MotifGCCCA  PLACE Motif 
 AtREG426 TAAGCCCA                PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  AAGCCCAA               PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402   AGCCCAAT              PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG418    GCCCAATT             PPDB MotifGCCCA  PLACE Motif 
 AtREG484            TTGGCCCA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG490             TGGCCCAT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG361              GGCCCATT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG357               GCCCATTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG396                CCCATTAA PPDB MotifGCCCA  PLACE MotifTTAATGG 
REGCATTGGGCCTTTA-2322765323227665AT3G62800.1, AT3G62800.2, AT3G62800.3
 AtREG461CATTGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG352 ATTGGGCC     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356  TTGGGCCT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG353   TGGGCCTT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG359    GGGCCTTT  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG467     GGCCTTTA PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.