version
PlantPromoterDB promoter information of AT3G63140.1

Summary of Gene (AT3G63140.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G63140  TAIR      NCBI 
Gene model AT3G63140.1  
Description Encodes a protein with ribonuclease activity that is involved in plastid rRNA maturation.  
#
#

Overview

Focused view (chromosome 3: 23329620-23328421)

Genome position     
from initiation codon
AT3G63150.1         
TSS from cDNA
TSS information
AT3G63140.1                      5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G63140.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA13-23328648-28

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-23328713-93
TSS cloneTclone-23328684-64
TSS cloneGclone-23328647-27
TSS cloneTclone-23328633-13
TSS cloneAclone-23328628-8

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGACCGTTGGAT-2332872123328731-101-111
 AtREG553GACCGTTG   Auxin PPDB MotifCCAACGG  PLACE MotifYAACKG, CNGTTR 
 AtREG554  CCGTTGGA  PPDB MotifCCAACGG  PLACE MotifYAACKG, CNGTTR 
 AtREG586   CGTTGGAT PPDB MotifCCAACGG  PLACE Motif 
REGATTTGGGCCAAT-2332877423328785-154-165
 AtREG421ATTTGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG373 TTTGGGCC    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG420  TTGGGCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG484   TGGGCCAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG446    GGGCCAATCK PPDB MotifGCCCA  PLACE MotifGGGCC 
REGTAAATGGGCCCATTT-2332879223328806-172-186
 AtREG443TAAATGGG        PPDB MotifGCCCA  PLACE Motif 
 AtREG386 AAATGGGCCCATTT PPDB MotifGCCCA  PLACE Motif 
 AtREG361  AATGGGCCCATT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG391   ATGGGCCCAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG422    TGGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGTAAACGACG-2332883423328842-214-222
 AtREG565TAAACGAC  PPDB Motif  PLACE Motif 
 AtREG415 AAACGACG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.