version
PlantPromoterDB promoter information of AT3G63170.1

Summary of Gene (AT3G63170.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G63170  TAIR      NCBI 
Gene model AT3G63170.1  
Description chalcone isomerase; FUNCTIONS IN: chalcone isomerase activity; INVOLVED IN: flavonoid biosynthetic process; LOCATED IN: mitochondrion, chloroplast, plastid, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chalcone isomerase, subgroup (InterPro:IPR003466), Chalcone isomerase (InterPro:IPR016087); BEST Arabidopsis thaliana protein match is: chalcone isomerase (TAIR:AT2G26310.1); Has 67 Blast hits to 67 proteins in 17 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 57; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 23333675-23334874)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G63170.1                      5'->3' (+)
Promoter sequence




 
AT3G63160.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence









 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G63170.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA8+23334623-52

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone+23334599-76
TSS cloneGclone+23334614-61

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCAATAT+2333437923334386-296-289
 AtREG509CCCAATAT PPDB Motif  PLACE Motif 
REGGGGCCTTT+2333441223334419-263-256
 AtREG359GGGCCTTT PPDB MotifGCCCA  PLACE MotifGGGCC 
REGAAAGCCCAAAT+2333443823334448-237-227
 AtREG376AAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407 AAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG469  AGCCCAAA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG421   GCCCAAAT PPDB MotifGCCCA  PLACE Motif 
REGAAAGCCCAAAC+2333447723334487-198-188
 AtREG376AAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407 AAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG469  AGCCCAAA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG474   GCCCAAAC PPDB MotifGCCCA  PLACE Motif 
REGGTCACGTG+2333451123334518-164-157
 AtREG583GTCACGTG PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 
REGTACACGTGTCA+2333452223334532-153-143
 AtREG453TACACGTG   ABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACACNNG 
 AtREG366  CACGTGTC ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACGTGKC, ACACNNG, ACGTGTC 
 AtREG389   ACGTGTCAABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA59-23334034AT3G63160.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneTclone-23334088AT3G63160.1
TSS cloneTclone-23334086AT3G63160.1
TSS cloneGclone-23334059AT3G63160.1
TSS cloneAclone-23334049AT3G63160.1
TSS cloneGclone-23334044AT3G63160.1
TSS cloneAclone-23334036AT3G63160.1
TSS cloneCclone-23334035AT3G63160.1
TSS cloneTclone-23334028AT3G63160.1
TSS cloneTclone-23334026AT3G63160.1
TSS cloneAclone-23334022AT3G63160.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTCAGCCCATATTAGGCCCAAAT-2333417223334193AT3G63160.1
 AtREG609TCAGCCCA               PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG477  AGCCCATA             PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG432   GCCCATAT            PPDB MotifGCCCA  PLACE Motif 
 AtREG506         ATTAGGCC      PPDB Motif  PLACE Motif 
 AtREG360          TTAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG358           TAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356            AGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG373             GGCCCAAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG421              GCCCAAAT PPDB MotifGCCCA  PLACE Motif 
REGACGACACC-2333422323334230AT3G63160.1
 AtREG599ACGACACC PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.