version
PlantPromoterDB promoter information of AT4G00170.1

Summary of Gene (AT4G00170.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G00170  TAIR      NCBI 
Gene model AT4G00170.1  
Description vesicle-associated membrane family protein / VAMP family protein; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: PapD-like (InterPro:IPR008962), Major sperm protein (InterPro:IPR000535), Vesicle-associated membrane protein (InterPro:IPR016763); BEST Arabidopsis thaliana protein match is: VAP (VESICLE ASSOCIATED PROTEIN); protein binding (TAIR:AT3G60600.1); Has 758 Blast hits to 742 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 363; Fungi - 101; Plants - 232; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 73085-71886)

Genome position     
from initiation codon
AT4G00180.1         
AT4G00180.2         
TSS from cDNA
TSS information
AT4G00170.1                      5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G00170.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG2-72175-90

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-72211-126

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTTCTTCTC-7215372163-68-78
Y PatchTTTCTTCTTCTCT-7219372205-108-120
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTACGTGGCAT-7226372272-178-187
 AtREG413TACGTGGC   PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG379 ACGTGGCA ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG448  CGTGGCATABA, DREB1Aox PPDB Motif  PLACE MotifGCCAC 
REGTGTTGGGCTAA-7232472334-239-249
 AtREG543TGTTGGGC    PPDB MotifGCCCA  PLACE MotifCAACA 
 AtREG574 GTTGGGCT   PPDB MotifGCCCA, CCAACGG  PLACE MotifTGGGCY 
 AtREG571   TGGGCTAA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGTGTTGGGCTTAT-7236372374-278-289
 AtREG543TGTTGGGC     PPDB MotifGCCCA  PLACE MotifCAACA 
 AtREG574 GTTGGGCT    PPDB MotifGCCCA, CCAACGG  PLACE MotifTGGGCY 
 AtREG407  TTGGGCTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG426   TGGGCTTA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG462    GGGCTTAT PPDB MotifGCCCA  PLACE Motif 
REGAAGGCCCACA-7239572404-310-319
 AtREG353AAGGCCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG482 AGGCCCAC  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG612  GGCCCACADREB1Aox PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGTGGGCTTTA-7240672414-321-329
 AtREG376TGGGCTTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG365 GGGCTTTA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.