version
PlantPromoterDB promoter information of AT4G01220.2

Summary of Gene (AT4G01220.2)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G01220  TAIR      NCBI 
Gene model AT4G01220.2  
Description FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Reticulon (InterPro:IPR003388); BEST Arabidopsis thaliana protein match is: RGXT1 (rhamnogalacturonan xylosyltransferase 1); UDP-xylosyltransferase (TAIR:AT4G01770.1); Has 188 Blast hits to 185 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 165; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 516648-515449)

Genome position     
from initiation codon
AT4G01220.1         
AT4G01230.1         
TSS from cDNA
TSS information
AT4G01220.2                      5'->3' (-)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G01220.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA2-515840-192

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-515853-205
TSS cloneGclone-515822-174
TSS cloneTclone-515821-173

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCCCTCC-515805515812-157-164
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCAAGCCCAATAG-515905515916-257-268
 AtREG525CAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407 AAGCCCAA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402  AGCCCAAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG355   GCCCAATA  PPDB MotifGCCCA  PLACE Motif 
 AtREG624    CCCAATAG PPDB MotifGCCCA  PLACE Motif 
REGGAATGGGCTTA-515929515939-281-291
 AtREG643GAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG372 AATGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378  ATGGGCTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG426   TGGGCTTA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGGGCTGGGCCTTG-516088516099-440-451
 AtREG454GGCTGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG410  CTGGGCCT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG353   TGGGCCTT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG398    GGGCCTTG PPDB MotifGCCCA  PLACE MotifGGGCC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.