version
PlantPromoterDB promoter information of AT4G01400.2

Summary of Gene (AT4G01400.2)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G01400  TAIR      NCBI 
Gene model AT4G01400.2  
Description FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: COG4 transport (InterPro:IPR013167), Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G46100.1); Has 11639 Blast hits to 3936 proteins in 180 species: Archae - 0; Bacteria - 2; Metazoa - 206; Fungi - 141; Plants - 11004; Viruses - 0; Other Eukaryotes - 286 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 575198-573999)

Genome position     
from initiation codon
AT4G01400.1         
TSS from cDNA
TSS information
AT4G01400.2                      5'->3' (-)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G01400.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA5-575677-29

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-575716-68
TSS cloneAclone-575677-29
TSS cloneGclone-575672-24
TSS cloneCclone-575671-23
TSS cloneAclone-575668-20

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAAGCCCATTT-575735575745-87-97
 AtREG426TAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378 AAGCCCAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372  AGCCCATT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG386   GCCCATTT PPDB MotifGCCCA  PLACE Motif 
REGGTGGGCCTTATTTGGGCTTTAT-575754575775-106-127
 AtREG482GTGGGCCT               PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG353 TGGGCCTT              PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG351  GGGCCTTA             PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG425   GGCCTTAT            PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG421         ATTTGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG469          TTTGGGCT     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407           TTGGGCTT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376            TGGGCTTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG365             GGGCTTTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG601              GGCTTTAT PPDB Motif  PLACE Motif 
REGTCGGTTTAG-575911575919-263-271
 AtREG514TCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG511 CGGTTTAG PPDB MotifAACCG(G/A)  PLACE Motif 
REGATAACCGGT-575945575953-297-305
 AtREG548ATAACCGG  PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG503 TAACCGGT PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.