version
PlantPromoterDB promoter information of AT4G02200.3

Summary of Gene (AT4G02200.3)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G02200  TAIR      NCBI 
Gene model AT4G02200.3  
Description drought-responsive family protein; INVOLVED IN: response to water deprivation; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Drought induced 19 (InterPro:IPR008598); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT1G02750.1).  
#
#

Overview

Focused view (chromosome 4: 971776-972975)

Genome position     
from initiation codon
AT4G02200.1         
AT4G02200.2         
TSS from cDNA
TSS information
AT4G02200.3                      5'->3' (+)
Promoter sequence


 
AT4G02195.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence













 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G02200.3

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+972726-50
TSS clone peakAclone+972732-44

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGTGGCGG+972478972485-298-291
 AtREG560CGTGGCGGABA PPDB MotifCCGAC  PLACE MotifGCCAC 
REGAAAGTCAA+972489972496-287-280
 AtREG632AAAGTCAA PPDB Motif  PLACE MotifTTGAC 
REGGACCGGTTA+972537972545-239-231
 AtREG552GACCGGTT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG503 ACCGGTTA PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG2-972315AT4G02195.1
TSS peakG2-972308AT4G02195.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone-972307AT4G02195.1
TSS cloneTclone-972304AT4G02195.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTCTCCTTC-972343972352AT4G02195.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTAAATGGGCCTAAAAAGGCCCAAAT-972354972378AT4G02195.1
 AtREG443TAAATGGG                  PPDB MotifGCCCA  PLACE Motif 
 AtREG386 AAATGGGC                 PPDB MotifGCCCA  PLACE Motif 
 AtREG361  AATGGGCC                PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354   ATGGGCCT               PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG358    TGGGCCTA              PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG360     GGGCCTAA             PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG430      GGCCTAAA            PPDB Motif  PLACE Motif 
 AtREG459            AAAAGGCC      PPDB Motif  PLACE Motif 
 AtREG359             AAAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353              AAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356               AGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG373                GGCCCAAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG421                 GCCCAAAT PPDB MotifGCCCA  PLACE Motif 
REGATAAGCCCAATAT-972380972392AT4G02195.1
 AtREG462ATAAGCCC      PPDB MotifGCCCA  PLACE Motif 
 AtREG426 TAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  AAGCCCAA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402   AGCCCAAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG355    GCCCAATA  PPDB MotifGCCCA  PLACE Motif 
 AtREG509     CCCAATAT PPDB Motif  PLACE Motif 
REGCCGCCACG-972478972485AT4G02195.1
 AtREG560CCGCCACGABA PPDB MotifCCGAC  PLACE MotifGCCAC 
REGTTGACTTT-972489972496AT4G02195.1
 AtREG632TTGACTTT PPDB Motif  PLACE MotifTTGAC 
REGTAACCGGTC-972537972545AT4G02195.1
 AtREG503TAACCGGT  PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG552 AACCGGTC PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.