version
PlantPromoterDB promoter information of AT4G04830.1

Summary of Gene (AT4G04830.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G04830  TAIR      NCBI 
Gene model AT4G04830.1  
Description methionine sulfoxide reductase domain-containing protein / SeIR domain-containing protein; FUNCTIONS IN: peptide-methionine-(S)-S-oxide reductase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Methionine sulphoxide reductase B (InterPro:IPR002579), Mss4-like (InterPro:IPR011057); BEST Arabidopsis thaliana protein match is: methionine sulfoxide reductase domain-containing protein / SeIR domain-containing protein (TAIR:AT4G04810.1); Has 5914 Blast hits to 5905 proteins in 1230 species: Archae - 53; Bacteria - 2684; Metazoa - 224; Fungi - 85; Plants - 108; Viruses - 1; Other Eukaryotes - 2759 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 2444902-2446101)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT4G04830.1                      5'->3' (+)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G04830.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA95+2445859-43

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+2445859-43
TSS cloneCclone+2445860-42

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCAATAA+24456002445607-302-295
 AtREG417CCCAATAA PPDB MotifGCCCA  PLACE Motif 
REGCCCATTAG+24456182445625-284-277
 AtREG558CCCATTAG PPDB MotifGCCCA  PLACE Motif 
REGGTAAACCGAACCGG+24456822445695-220-207
 AtREG519GTAAACCG       PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514 TAAACCGA      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568  AAACCGAA     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG556   AACCGAAC    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451    ACCGAACC   PPDB Motif  PLACE Motif 
 AtREG456     CCGAACCG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG423      CGAACCGG PPDB MotifAACCG(G/A)  PLACE Motif 
REGATAATGGG+24457022445709-200-193
 AtREG546ATAATGGG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.