version
PlantPromoterDB promoter information of AT4G05420.2

Summary of Gene (AT4G05420.2)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G05420  TAIR      NCBI 
Gene model AT4G05420.2  
Description Structurally similar to damaged DNA binding proteins.DDB1a is part of a 350 KDa nuclear localized DET1 protein complex. This complex may physically interact with histone tails and while bound to chromatin- repress transcription of genes involved in photomorphogenesis.  
#
#

Overview

Focused view (chromosome 4: 2745288-2746487)

Genome position     
from initiation codon
AT4G05420.1         
TSS from cDNA
TSS information
AT4G05420.2                      5'->3' (+)
Promoter sequence






 
AT4G05410.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence






 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G05420.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG5+2746138-150
TSS peakG2+2746284-4

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone+2746122-166
TSS cloneAclone+2746166-122
TSS cloneTclone+2746167-121
TSS cloneGclone+2746236-52

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTTCTTCTTCCT+27461242746136-164-152
Y PatchTTCTCTCTCT+27461672746176-121-112
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTAAACCGAA+27458842745893-404-395
 AtREG519GTAAACCG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514 TAAACCGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568  AAACCGAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTCCGGTTTAA+27459852745995-303-293
 AtREG534TTCCGGTT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521 TCCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412  CCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG473   CGGTTTAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGGTTCGGTTTAG+27460092746019-279-269
 AtREG556GTTCGGTT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568 TTCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514  TCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG511   CGGTTTAG PPDB MotifAACCG(G/A)  PLACE Motif 
REGACCGAACCGGAC+27460532746064-235-224
 AtREG451ACCGAACC     PPDB Motif  PLACE Motif 
 AtREG456 CCGAACCG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG423  CGAACCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG579   GAACCGGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG573    AACCGGAC PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone-2745627AT4G05410.1
TSS clone peakAclone-2745626AT4G05410.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTCTTCC-27456052745612AT4G05410.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAACCCGGT-27456932745700AT4G05410.1
 AtREG516AACCCGGT PPDB Motif  PLACE Motif 
REGATGGGCTTG-27457142745722AT4G05410.1
 AtREG378ATGGGCTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG525 TGGGCTTG PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGTTAATGGGCTCA-27457432745754AT4G05410.1
 AtREG396TTAATGGG     PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG357 TAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG372  AATGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG485    TGGGCTCA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGTTAAAGGCCCAAG-27457802745792AT4G05410.1
 AtREG639TTAAAGGC      PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG467 TAAAGGCC     PPDB Motif  PLACE Motif 
 AtREG359  AAAGGCCC    PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353   AAGGCCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356    AGGCCCAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG505     GGCCCAAG PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGGTCCGGTTA-27458102745818AT4G05410.1
 AtREG573GTCCGGTT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG621 TCCGGTTA PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
REGTTCGGTTTAC-27458842745893AT4G05410.1
 AtREG568TTCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514 TCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG519  CGGTTTAC PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.