version
PlantPromoterDB promoter information of AT4G08960.1

Summary of Gene (AT4G08960.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G08960  TAIR      NCBI 
Gene model AT4G08960.1  
Description phosphotyrosyl phosphatase activator (PTPA) family protein; FUNCTIONS IN: phosphatase activator activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phosphotyrosyl phosphatase activator, PTPA (InterPro:IPR004327); Has 593 Blast hits to 585 proteins in 175 species: Archae - 0; Bacteria - 4; Metazoa - 247; Fungi - 211; Plants - 54; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 5745326-5746525)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT4G08960.1                      5'->3' (+)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G08960.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+5746289-37
TSS cloneAclone+5746292-34
TSS clone peakTclone+5746293-33
TSS cloneGclone+5746304-22
TSS cloneTclone+5746305-21

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAAGGGTAT+57460575746065-269-261
 AtREG570TAAGGGTA  PPDB MotifACCCT  PLACE Motif 
 AtREG623 AAGGGTAT PPDB MotifACCCT  PLACE Motif 
REGTTTGGGCTTATTATTGGG+57461495746166-177-160
 AtREG469TTTGGGCT           PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407 TTGGGCTT          PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG426  TGGGCTTA         PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG462   GGGCTTAT        PPDB MotifGCCCA  PLACE Motif 
 AtREG417          TTATTGGG PPDB MotifGCCCA  PLACE Motif 
REGTTTGGGCTTATTATTGGG+57461805746197-146-129
 AtREG469TTTGGGCT           PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407 TTGGGCTT          PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG426  TGGGCTTA         PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG462   GGGCTTAT        PPDB MotifGCCCA  PLACE Motif 
 AtREG417          TTATTGGG PPDB MotifGCCCA  PLACE Motif 
REGTTTGGGCTTAT+57462115746221-115-105
 AtREG469TTTGGGCT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407 TTGGGCTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG426  TGGGCTTA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG462   GGGCTTAT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.