version
PlantPromoterDB promoter information of AT4G09150.1

Summary of Gene (AT4G09150.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G09150  TAIR      NCBI 
Gene model AT4G09150.1  
Description T-complex protein 11; FUNCTIONS IN: phosphopantetheine binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: T-complex 11 (InterPro:IPR008862), Phosphopantetheine attachment site (InterPro:IPR006162); BEST Arabidopsis thaliana protein match is: T-complex protein 11 (TAIR:AT1G22930.1); Has 12960 Blast hits to 8305 proteins in 753 species: Archae - 49; Bacteria - 1704; Metazoa - 5727; Fungi - 995; Plants - 381; Viruses - 20; Other Eukaryotes - 4084 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 5826803-5828002)

Genome position     
from initiation codon
AT4G09146.1         
TSS from cDNA
TSS information
AT4G09150.1                      5'->3' (+)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G09150.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG8+5828519-234

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTTCTTCT+58284995828506-254-247
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGGCCCAATAGTAAGCCCATATA+58284225828444-331-309
 AtREG420TGGCCCAA                PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352 GGCCCAAT               PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG355  GCCCAATA              PPDB MotifGCCCA  PLACE Motif 
 AtREG624   CCCAATAG             PPDB MotifGCCCA  PLACE Motif 
 AtREG426           TAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378            AAGCCCAT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG477             AGCCCATA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG432              GCCCATAT  PPDB MotifGCCCA  PLACE Motif 
 AtREG620               CCCATATA PPDB MotifGCCCA  PLACE Motif 
REGTCGGTTTAT+58284555828463-298-290
 AtREG514TCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG598 CGGTTTAT PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.