version
PlantPromoterDB promoter information of AT4G10750.1

Summary of Gene (AT4G10750.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G10750  TAIR      NCBI 
Gene model AT4G10750.1  
Description HpcH/HpaI aldolase family protein; FUNCTIONS IN: carbon-carbon lyase activity, catalytic activity; INVOLVED IN: in 8 processes; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pyruvate/Phosphoenolpyruvate kinase, catalytic core (InterPro:IPR015813), HpcH/HpaI aldolase (InterPro:IPR005000); BEST Arabidopsis thaliana protein match is: ALL1 (Aldolase like); carbon-carbon lyase/ catalytic (TAIR:AT4G24080.1); Has 2940 Blast hits to 2939 proteins in 494 species: Archae - 8; Bacteria - 1472; Metazoa - 0; Fungi - 122; Plants - 25; Viruses - 0; Other Eukaryotes - 1313 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 6617724-6618923)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT4G10750.1                      5'->3' (+)
Promoter sequence





 
AT4G10740.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G10750.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA2+6618663-61

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone+6618666-58
TSS cloneTclone+6618685-39

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACCCTAGA+66183686618375-356-349
 AtREG658ACCCTAGA PPDB MotifACCCT  PLACE Motif 
REGAGTTGGGCTAA+66185146618524-210-200
 AtREG607AGTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG574 GTTGGGCT   PPDB MotifGCCCA, CCAACGG  PLACE MotifTGGGCY 
 AtREG571   TGGGCTAA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGGGGCTTTTT+66185486618556-176-168
 AtREG409GGGCTTTT  PPDB MotifGCCCA  PLACE Motif 
 AtREG589 GGCTTTTT PPDB Motif  PLACE Motif 
REGTAAAAGCCCTA+66185586618568-166-156
 AtREG549TAAAAGCC    PPDB Motif  PLACE Motif 
 AtREG409 AAAAGCCC   PPDB MotifGCCCA  PLACE Motif 
 AtREG651   AAGCCCTA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.