version
PlantPromoterDB promoter information of AT4G12730

Summary of Gene (AT4G12730)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G12730  TAIR      NCBI 
Gene model AT4G12730  
Description AF333971 Arabidopsis thaliana fasciclin-like arabinogalactan-protein 2 (Fla2) mRNA, complete cds  
#
#

Overview

Focused view (chromosome 4: 7487509-7486310)

Genome position     
from initiation codon
AT4G12710.1         
TSS from cDNA
TSS information
AT4G12730                        5'->3' (-)
Promoter sequence


 
AT4G12720.1         
AT4G12720.2         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G12730

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA54-7492861-52

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-7492866-57
TSS cloneTclone-7492864-55
TSS cloneAclone-7492861-52
TSS cloneAclone-7492854-45
TSS cloneTclone-7492837-28

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTTTATATATCT-74928867492896-77-87
Y PatchTCCTCTCC-74928627492869-53-60
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGCCCACT-74929497492956-140-147
 AtREG510AGCCCACT PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGTTGAACCGGGCCTTAA-74930307493045-221-236
 AtREG640TTGAACCG         PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG480 TGAACCGG        PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG351       GGGCCTTA  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG416        GGCCTTAA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA4-7486777AT4G12710.1
TSS peakA4-7486773AT4G12710.1
TSS peakA4+7487354AT4G12720.1, AT4G12720.2, AT4G12720.3

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone-7486801AT4G12710.1
TSS cloneAclone-7486783AT4G12710.1
TSS cloneGclone+7487476AT4G12720.1, AT4G12720.2, AT4G12720.3

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTCTTCT+74873367487343AT4G12720.1, AT4G12720.2, AT4G12720.3
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGATATGGGCT-74868567486864AT4G12710.1
 AtREG432ATATGGGC  PPDB MotifGCCCA  PLACE Motif 
 AtREG477 TATGGGCT PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGCGGTTAAA+74871417487148AT4G12720.1, AT4G12720.2, AT4G12720.3
 AtREG645CGGTTAAA PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
REGTAAACGAC+74872387487245AT4G12720.1, AT4G12720.2, AT4G12720.3
 AtREG565TAAACGAC PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.