version
PlantPromoterDB promoter information of AT4G13820

Summary of Gene (AT4G13820)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G13820  TAIR      NCBI 
Gene model AT4G13820  
Description disease resistance family protein / LRR family protein; FUNCTIONS IN: protein binding, kinase activity; INVOLVED IN: signal transduction; LOCATED IN: endomembrane system; EXPRESSED IN: stem, leaf whorl, hypocotyl, root, leaf; EXPRESSED DURING: LP.06 six leaves visible; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: AtRLP50 (Receptor Like Protein 50); kinase/ protein binding (TAIR:AT4G13920.1); Has 52051 Blast hits to 16651 proteins in 741 species: Archae - 20; Bacteria - 2791; Metazoa - 12150; Fungi - 442; Plants - 33000; Viruses - 20; Other Eukaryotes - 3628 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 8012394-8011195)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT4G13820                        5'->3' (-)
Promoter sequence

 
AT4G13830.1         
AT4G13830.2         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence









 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G13820

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-8010743-49

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakTclone+8011402AT4G13830.1, AT4G13830.2
TSS clone peakAclone+8011432AT4G13830.1, AT4G13830.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCCTCCCTCTCTCCC+80114068011423AT4G13830.1, AT4G13830.2
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCTAATGGGCT+80112258011234AT4G13830.1, AT4G13830.2
 AtREG558CTAATGGG   PPDB MotifGCCCA  PLACE Motif 
 AtREG357 TAATGGGC  PPDB MotifGCCCA  PLACE Motif 
 AtREG372  AATGGGCT PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGGAAGCCCAAAA+80112488011258AT4G13830.1, AT4G13830.2
 AtREG476GAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407 AAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG469  AGCCCAAA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG529   GCCCAAAA PPDB MotifGCCCA  PLACE Motif 
REGATAAGGGC+80112658011272AT4G13830.1, AT4G13830.2
 AtREG616ATAAGGGC PPDB Motif  PLACE Motif 
REGAAATACCCTT+80113618011370AT4G13830.1, AT4G13830.2
 AtREG602AAATACCC   PPDB Motif  PLACE Motif 
 AtREG567 AATACCCT  PPDB MotifACCCT  PLACE Motif 
 AtREG623  ATACCCTT PPDB MotifACCCT  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.