version
PlantPromoterDB promoter information of AT4G13830.2

Summary of Gene (AT4G13830.2)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G13830  TAIR      NCBI 
Gene model AT4G13830.2  
Description DnaJ-like protein (J20); nuclear gene  
#
#

Overview

Focused view (chromosome 4: 8013318-8014517)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT4G13830.2                      5'->3' (+)
Promoter sequence

 
AT4G13840.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G13830.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakTclone+8011402-116
TSS clone peakAclone+8011432-86

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCCTCCCTCTCTCCC+80114068011423-112-95
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCTAATGGGCT+80112258011234-293-284
 AtREG558CTAATGGG   PPDB MotifGCCCA  PLACE Motif 
 AtREG357 TAATGGGC  PPDB MotifGCCCA  PLACE Motif 
 AtREG372  AATGGGCT PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGGAAGCCCAAAA+80112488011258-270-260
 AtREG476GAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407 AAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG469  AGCCCAAA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG529   GCCCAAAA PPDB MotifGCCCA  PLACE Motif 
REGATAAGGGC+80112658011272-253-246
 AtREG616ATAAGGGC PPDB Motif  PLACE Motif 
REGAAATACCCTT+80113618011370-157-148
 AtREG602AAATACCC   PPDB Motif  PLACE Motif 
 AtREG567 AATACCCT  PPDB MotifACCCT  PLACE Motif 
 AtREG623  ATACCCTT PPDB MotifACCCT  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.