version
PlantPromoterDB promoter information of AT4G14040

Summary of Gene (AT4G14040)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G14040  TAIR      NCBI 
Gene model AT4G14040  
Description SELENIUM-BINDING PROTEIN 2 (SBP2); FUNCTIONS IN: selenium binding; INVOLVED IN: polar nucleus fusion; LOCATED IN: cellular_component unknown; EXPRESSED IN: guard cell; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Cytochrome cd1-nitrite reductase-like, C-terminal haem d1 (InterPro:IPR011048), Selenium-binding protein (InterPro:IPR008826); BEST Arabidopsis thaliana protein match is: SBP1 (selenium-binding protein 1); selenium binding (TAIR:AT4G14030.1); Has 764 Blast hits to 757 proteins in 154 species: Archae - 15; Bacteria - 128; Metazoa - 187; Fungi - 0; Plants - 55; Viruses - 0; Other Eukaryotes - 379 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 8103828-8102629)

Genome position     
from initiation codon
AT4G14040.1         
AT4G14050.1         
TSS from cDNA
TSS information
AT4G14040                        5'->3' (-)
Promoter sequence




 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G14040

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA2-8103046-218
TSS peakA18-8102875-47

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-8102875-47
TSS cloneTclone-8102874-46
TSS cloneAclone-8102869-41
TSS cloneGclone-8102863-35
TSS cloneTclone-8102841-13

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTCATATATATC-81028998102909-71-81
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAACGACAC-81029618102968-133-140
 AtREG527AACGACACDREB1Aox PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.