version
PlantPromoterDB promoter information of AT4G14880.2

Summary of Gene (AT4G14880.2)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G14880  TAIR      NCBI 
Gene model AT4G14880.2  
Description Encodes a cytosolic isoform of cytosolic O-acetylserine(thiol)lyase, a key enzyme in cysteine biosynthesis and for the fixation of inorganic sulfide. It catalyzes the formation of cysteine from O-acetylserine and inorganic sulfide. Gene expression is predominant in the root cortex and the xylem parenchyma. Gene expression is induced in leave, stems and roots by high salt and heavy metal stresses, mediated by ABA.  
#
#

Overview

Focused view (chromosome 4: 8521050-8519851)

Genome position     
from initiation codon
AT4G14880.1         
TSS from cDNA
TSS information
AT4G14880.2                      5'->3' (-)
Promoter sequence



 
AT4G14890.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence






 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G14880.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA34-8520395-345

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-8520468-418
TSS cloneAclone-8520467-417
TSS cloneCclone-8520437-387
TSS cloneCclone-8520398-348
TSS cloneAclone-8520397-347
TSS cloneTclone-8520396-346
TSS cloneAclone-8520395-345
TSS cloneCclone-8520394-344
TSS cloneAclone-8520354-304

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTCATATATCT-85204208520429-370-379
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGCGTTTT-85204728520479-422-429
 AtREG566CGCGTTTT PPDB MotifAAACG(C/G)  PLACE Motif 
REGTTAACCGGAC-85205368520545-486-495
 AtREG501TTAACCGG   PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG621 TAACCGGA  PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG573  AACCGGAC PPDB MotifAACCG(G/A)  PLACE Motif 
REGAAACCGAA-85205728520579-522-529
 AtREG568AAACCGAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGCGTAATTA-85206728520679-622-629
 AtREG646CGTAATTAABA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG10+8520866AT4G14890.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone+8520832AT4G14890.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCGTCTCTC+85208718520878AT4G14890.1
Y PatchTCTCTCAT+85208818520888AT4G14890.1
Y PatchCTCTTCCTCTCC+85208948520905AT4G14890.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTTCGGTTT+85205728520579AT4G14890.1
 AtREG568TTCGGTTT PPDB MotifAACCG(G/A)  PLACE Motif 
REGTAATTACG+85206728520679AT4G14890.1
 AtREG646TAATTACGABA PPDB Motif  PLACE Motif 
REGTTCGGTTTAA+85207258520734AT4G14890.1
 AtREG568TTCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514 TCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG473  CGGTTTAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTCGGTTTAAGTCGGTTTTCGGTTT+85207488520772AT4G14890.1
 AtREG568TTCGGTTT         TTCGGTTT PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514 TCGGTTTA                 PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG473  CGGTTTAA                PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG582       TAAGTCGG           PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG641         AGTCGGTT         PPDB MotifAACCG(G/A), CCGAC  PLACE MotifCCGAC, RCCGAC 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.