version
PlantPromoterDB promoter information of AT4G14905.1

Summary of Gene (AT4G14905.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G14905  TAIR      NCBI 
Gene model AT4G14905.1  
Description kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT4G39240.1); Has 1209 Blast hits to 1171 proteins in 90 species: Archae - 0; Bacteria - 13; Metazoa - 536; Fungi - 5; Plants - 603; Viruses - 14; Other Eukaryotes - 38 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 8530547-8529348)

Genome position     
from initiation codon
AT4G14910.1         
AT4G14910.2         
TSS from cDNA
TSS information
AT4G14905.1                      5'->3' (-)
Promoter sequence




 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G14905.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA2-8528007-10

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-8528010-13
TSS cloneTclone-8528003-6

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTTTC-85280118528018-14-21
Y PatchTTTCTTCTCC-85280218528030-24-33
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAATGGGCTTTATAGGCCCATTT-85280618528083-64-86
 AtREG386AAATGGGC       GCCCATTT PPDB MotifGCCCA  PLACE Motif 
 AtREG372 AATGGGCT               PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378  ATGGGCTT              PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376   TGGGCTTT             PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG365    GGGCTTTA            PPDB MotifGCCCA  PLACE Motif 
 AtREG601     GGCTTTAT           PPDB Motif  PLACE Motif 
 AtREG487          TATAGGCC      PPDB Motif  PLACE Motif 
 AtREG362           ATAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG358            TAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354             AGGCCCAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG361              GGCCCATT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGAGGCCTATT-85280908528098-93-101
 AtREG649AGGCCTAT  PPDB Motif  PLACE Motif 
 AtREG424 GGCCTATT PPDB Motif  PLACE Motif 
REGTCGTCGTTTC-85281348528143-137-146
 AtREG648TCGTCGTT   PPDB Motif  PLACE Motif 
 AtREG415 CGTCGTTT  PPDB Motif  PLACE Motif 
 AtREG576  GTCGTTTC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone-8530114AT4G14910.1, AT4G14910.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCTTCTTC-85300868530096AT4G14910.1, AT4G14910.2
Y PatchCTCTTCCT-85301158530122AT4G14910.1, AT4G14910.2
Y PatchTCTTTCTCT-85301248530132AT4G14910.1, AT4G14910.2
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGACGACGTCGTT-85301658530175AT4G14910.1, AT4G14910.2
 AtREG431ACGACGTCGT  PPDB MotifACGT  PLACE MotifACGT 
 AtREG493   ACGTCGTT PPDB MotifACGT  PLACE MotifACGT 
REGAACGACAC-85301868530193AT4G14910.1, AT4G14910.2
 AtREG527AACGACACDREB1Aox PPDB Motif  PLACE Motif 
REGACACGTCACG-85302708530279AT4G14910.1, AT4G14910.2
 AtREG517ACACGTCA  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG466 CACGTCAC ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG489  ACGTCACGABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.