version
PlantPromoterDB promoter information of AT4G14965.1

Summary of Gene (AT4G14965.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G14965  TAIR      NCBI 
Gene model AT4G14965.1  
Description Arabidopsis thaliana membrane-associated progesterone binding protein 4 (AtMAPR4); FUNCTIONS IN: heme binding; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome b5 (InterPro:IPR001199); BEST Arabidopsis thaliana protein match is: AtMAPR2 (Arabidopsis thaliana membrane-associated progesterone binding protein 2); heme binding (TAIR:AT2G24940.1); Has 737 Blast hits to 737 proteins in 131 species: Archae - 0; Bacteria - 0; Metazoa - 352; Fungi - 216; Plants - 120; Viruses - 0; Other Eukaryotes - 49 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 8550356-8551555)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT4G14965.1                      5'->3' (+)
Promoter sequence

 
AT4G14960.1         
AT4G14960.2         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence




 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G14965.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+8551244-112
TSS clone peakTclone+8551310-46

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG4-8550418AT4G14960.1, AT4G14960.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneTclone-8550431AT4G14960.1, AT4G14960.2
TSS cloneAclone-8550430AT4G14960.1, AT4G14960.2
TSS cloneAclone-8550429AT4G14960.1, AT4G14960.2
TSS cloneCclone-8550428AT4G14960.1, AT4G14960.2
TSS cloneTclone-8550426AT4G14960.1, AT4G14960.2
TSS cloneAclone-8550425AT4G14960.1, AT4G14960.2
TSS cloneGclone-8550424AT4G14960.1, AT4G14960.2
TSS cloneTclone-8550420AT4G14960.1, AT4G14960.2
TSS cloneGclone-8550418AT4G14960.1, AT4G14960.2
TSS cloneAclone-8550414AT4G14960.1, AT4G14960.2
TSS cloneTclone-8550411AT4G14960.1, AT4G14960.2
TSS cloneAclone-8550403AT4G14960.1, AT4G14960.2
TSS cloneAclone-8550402AT4G14960.1, AT4G14960.2
TSS cloneAclone-8550360AT4G14960.1, AT4G14960.2
TSS cloneTclone-8550357AT4G14960.1, AT4G14960.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxCTTATAAAAT-85504548550463AT4G14960.1, AT4G14960.2
Y PatchCCTTCCTC-85504338550440AT4G14960.1, AT4G14960.2
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTACACGTGTA-85505018550510AT4G14960.1, AT4G14960.2
 AtREG453TACACGTGTAABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACACNNG 
REGCCCAATTA-85505178550524AT4G14960.1, AT4G14960.2
 AtREG600CCCAATTA PPDB MotifGCCCA  PLACE Motif 
REGTTCCGGTTAAG-85506218550631AT4G14960.1, AT4G14960.2
 AtREG534TTCCGGTT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG621 TCCGGTTA   PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG501  CCGGTTAA  PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG605   CGGTTAAG PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
REGCGGTTCAA-85506448550651AT4G14960.1, AT4G14960.2
 AtREG640CGGTTCAA PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.