version
PlantPromoterDB promoter information of AT4G15010.1

Summary of Gene (AT4G15010.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G15010  TAIR      NCBI 
Gene model AT4G15010.1  
Description mitochondrial substrate carrier family protein; FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: endomembrane system, mitochondrial inner membrane, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); Has 3824 Blast hits to 3539 proteins in 214 species: Archae - 0; Bacteria - 0; Metazoa - 1741; Fungi - 1051; Plants - 775; Viruses - 0; Other Eukaryotes - 257 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 8575864-8574665)

Genome position     
from initiation codon
AT4G15010.2         
AT4G15010.3         
TSS from cDNA
TSS information
AT4G15010.1                      5'->3' (-)
Promoter sequence






 
AT4G15020.1         
AT4G15020.2         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence




 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G15010.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-8575231-367
TSS clone peakTclone-8575208-344
TSS cloneTclone-8575181-317

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCGTCTTCTTCGTCTTCTCTCT-85751728575192-308-328
Y PatchTTTCTTCTCC-85752068575215-342-351
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAACGACGTCATTT-85752518575265-387-401
 AtREG520AAAACGAC        PPDB Motif  PLACE Motif 
 AtREG415 AAACGACG       PPDB Motif  PLACE Motif 
 AtREG493  AACGACGT      PPDB MotifACGT  PLACE MotifACGT 
 AtREG431   ACGACGTC     PPDB MotifACGT  PLACE MotifACGT 
 AtREG657       CGTCATTT PPDB Motif  PLACE Motif 
REGCGTGACGT-85753338575340-469-476
 AtREG489CGTGACGTABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT 
REGTCGACCCGGCCCGTT-85754118575425-547-561
 AtREG539TCGACCCG        PPDB Motif  PLACE Motif 
 AtREG494 CGACCCGG       PPDB Motif  PLACE Motif 
 AtREG404    CCCGGCCC   CK PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG401       GGCCCGTT PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE MotifGGGCC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone+8575651AT4G15020.1, AT4G15020.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTCTTC+85756038575610AT4G15020.1, AT4G15020.2
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAACGGGCCGGGTCGA+85754118575425AT4G15020.1, AT4G15020.2
 AtREG401AACGGGCC        PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE MotifGGGCC 
 AtREG404   GGGCCGGG    CK PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG494      CCGGGTCG  PPDB Motif  PLACE Motif 
 AtREG539       CGGGTCGA PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.