version
PlantPromoterDB promoter information of AT4G16450.1

Summary of Gene (AT4G16450.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G16450  TAIR      NCBI 
Gene model AT4G16450.1  
Description unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, respiratory chain complex I, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 50 Blast hits to 50 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 25; Plants - 25; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 9279132-9280331)

Genome position     
from initiation codon
AT4G16447.1         
TSS from cDNA
TSS information
AT4G16450.1                      5'->3' (+)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G16450.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA17+9280084-48

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone+9280085-47
TSS cloneAclone+9280086-46
TSS cloneTclone+9280102-30

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAAATGGGCTCATTCGGGTC+92799439279962-189-170
 AtREG443TAAATGGG             PPDB MotifGCCCA  PLACE Motif 
 AtREG386 AAATGGGC            PPDB MotifGCCCA  PLACE Motif 
 AtREG372  AATGGGCT           PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG485    TGGGCTCA         PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG597            TTCGGGTC PPDB MotifGGGACCC  PLACE Motif 
REGAAAGCCCAAC+92799729279981-160-151
 AtREG376AAAGCCCA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407 AAGCCCAA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG574  AGCCCAAC PPDB MotifGCCCA, CCAACGG  PLACE MotifTGGGCY 
REGGGGTCAAA+92799959280002-137-130
 AtREG592GGGTCAAA PPDB Motif  PLACE MotifTTGAC, TTGACC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.