version
PlantPromoterDB promoter information of AT4G17050.1

Summary of Gene (AT4G17050.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G17050  TAIR      NCBI 
Gene model AT4G17050.1  
Description UREIDOGLYCINE AMINOHYDROLASE (UGLYAH); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Cupin 2, conserved barrel (InterPro:IPR013096), Cupin, RmlC-type (InterPro:IPR011051), RmlC-like jelly roll fold (InterPro:IPR014710); Has 513 Blast hits to 513 proteins in 229 species: Archae - 4; Bacteria - 414; Metazoa - 0; Fungi - 9; Plants - 21; Viruses - 0; Other Eukaryotes - 65 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 9588662-9589861)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT4G17050.1                      5'->3' (+)
Promoter sequence








 
AT4G17040.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence









 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G17050.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG4+9589553-109
TSS peakA4+9589645-17

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone+9589571-91
TSS cloneTclone+9589575-87
TSS cloneAclone+9589616-46

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTTTATAAACA+95896139589622-49-40
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTATGGGCTCA+95893909589400-272-262
 AtREG394TTATGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG477 TATGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG485   TGGGCTCA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGAATAGGCCCAATAG+95894049589417-258-245
 AtREG424AATAGGCC       PPDB Motif  PLACE Motif 
 AtREG362 ATAGGCCC      PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG358  TAGGCCCA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356   AGGCCCAA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352    GGCCCAAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG355     GCCCAATA  PPDB MotifGCCCA  PLACE Motif 
 AtREG624      CCCAATAG PPDB MotifGCCCA  PLACE Motif 
REGTTCCGGTTT+95894439589451-219-211
 AtREG534TTCCGGTT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521 TCCGGTTT PPDB MotifAACCG(G/A)  PLACE Motif 
REGAAACCGAA+95894749589481-188-181
 AtREG568AAACCGAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGAAAACCGG+95894849589491-178-171
 AtREG542AAAACCGG PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA4-9589338AT4G17040.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneTclone-9589356AT4G17040.1
TSS cloneCclone-9589339AT4G17040.1
TSS cloneAclone-9589328AT4G17040.1
TSS cloneTclone-9589320AT4G17040.1
TSS cloneCclone-9589317AT4G17040.1
TSS cloneTclone-9589312AT4G17040.1
TSS cloneAclone-9589308AT4G17040.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTTTCTCTCTCTCT-95893129589327AT4G17040.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTGAGCCCATAA-95893909589400AT4G17040.1
 AtREG485TGAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG477  AGCCCATA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG394   GCCCATAA PPDB MotifGCCCA  PLACE Motif 
REGCTATTGGGCCTATT-95894049589417AT4G17040.1
 AtREG624CTATTGGG       PPDB MotifGCCCA  PLACE Motif 
 AtREG355 TATTGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG352  ATTGGGCC     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356   TTGGGCCT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG358    TGGGCCTA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG362     GGGCCTAT  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG424      GGCCTATT PPDB Motif  PLACE Motif 
REGAAACCGGAA-95894439589451AT4G17040.1
 AtREG521AAACCGGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534 AACCGGAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTCGGTTT-95894749589481AT4G17040.1
 AtREG568TTCGGTTT PPDB MotifAACCG(G/A)  PLACE Motif 
REGCCGGTTTT-95894849589491AT4G17040.1
 AtREG542CCGGTTTT PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.