version
PlantPromoterDB promoter information of AT4G17240

Summary of Gene (AT4G17240)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G17240  TAIR      NCBI 
Gene model AT4G17240  
Description unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; Has 43 Blast hits to 43 proteins in 14 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 2; Plants - 21; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 9669292-9668093)

Genome position     
from initiation codon
AT4G17240.1         
TSS from cDNA
TSS information
AT4G17240                        5'->3' (-)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G17240

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG8-9668394-102

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone-9668320-28

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCCCTCT-96683579668364-65-72
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTAAAGCCCATAGTTAGGCCCAATA-96684479668471-155-179
 AtREG545TTAAAGCC                  PPDB Motif  PLACE Motif 
 AtREG365 TAAAGCCC                 PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA                PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378   AAGCCCAT               PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG477    AGCCCATA              PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG535            GTTAGGCC      PPDB Motif  PLACE Motif 
 AtREG360             TTAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG358              TAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356               AGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352                GGCCCAAT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG355                 GCCCAATA PPDB MotifGCCCA  PLACE Motif 
REGCCGTTAAA-96684759668482-183-190
 AtREG610CCGTTAAA PPDB Motif  PLACE MotifYAACKG, CNGTTR 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGATCCACGT+96692429669249AT4G17245.1
 AtREG547ATCCACGTABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.