version
PlantPromoterDB promoter information of AT4G18460.1

Summary of Gene (AT4G18460.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G18460  TAIR      NCBI 
Gene model AT4G18460.1  
Description D-Tyr-tRNA(Tyr) deacylase family protein; FUNCTIONS IN: hydrolase activity, acting on ester bonds; INVOLVED IN: D-amino acid catabolic process; LOCATED IN: cytoplasm; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: D-tyrosyl-tRNA(Tyr) deacylase (InterPro:IPR003732); Has 3035 Blast hits to 3034 proteins in 1108 species: Archae - 3; Bacteria - 2050; Metazoa - 120; Fungi - 93; Plants - 20; Viruses - 0; Other Eukaryotes - 749 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 10197679-10196480)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT4G18460.1                      5'->3' (-)
Promoter sequence




 
AT4G18465.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence




 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G18460.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTCTTCTTCC-1019678510196795-106-116
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGGTTCGGTTT-1019686210196872-183-193
 AtREG655TGGTTCGG    PPDB Motif  PLACE Motif 
 AtREG451 GGTTCGGT   PPDB Motif  PLACE Motif 
 AtREG556  GTTCGGTT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568   TTCGGTTT PPDB MotifAACCG(G/A)  PLACE Motif 
REGCGGTTCAA-1019688910196896-210-217
 AtREG640CGGTTCAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTCGGGTC-1019692710196934-248-255
 AtREG597TTCGGGTC PPDB MotifGGGACCC  PLACE Motif 
REGGGCTTTTT-1019699610197003-317-324
 AtREG589GGCTTTTT PPDB Motif  PLACE Motif 
REGCAAAACGCC-1019705810197066-379-387
 AtREG585CAAAACGC  PPDB MotifAAACG(C/G)  PLACE MotifCAAAACGC 
 AtREG650 AAAACGCC PPDB MotifAAACG(C/G)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG2+10197016AT4G18465.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAAACCGAACCA+1019686210196872AT4G18465.1
 AtREG568AAACCGAA    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG556 AACCGAAC   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451  ACCGAACC  PPDB Motif  PLACE Motif 
 AtREG655   CCGAACCA PPDB Motif  PLACE Motif 
REGTTGAACCG+1019688910196896AT4G18465.1
 AtREG640TTGAACCG PPDB MotifAACCG(G/A)  PLACE Motif 
REGGACCCGAA+1019692710196934AT4G18465.1
 AtREG597GACCCGAA PPDB MotifGGGACCC  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.