version
PlantPromoterDB promoter information of AT4G18580.2

Summary of Gene (AT4G18580.2)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G18580  TAIR      NCBI 
Gene model AT4G18580.2  
Description unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 5 Blast hits to 5 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 5; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 10236674-10235475)

Genome position     
from initiation codon
AT4G18580.1         
TSS from cDNA
TSS information
AT4G18580.2                      5'->3' (-)
Promoter sequence










 
AT4G18590.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence










 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G18580.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG5-10236026-502

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTTCTCTT-1023598210235991-458-467
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGACACGTCAGC-1023612010236131-596-607
 AtREG470AGACACGT    ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 
 AtREG481 GACACGTC   ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 
 AtREG517  ACACGTCA  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG440   CACGTCAG ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG515    ACGTCAGCSA PPDB MotifACGT  PLACE MotifACGT 
REGTTAAACCGAACCGGTTTG-1023616710236184-643-660
 AtREG473TTAAACCG           PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514 TAAACCGA          PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568  AAACCGAA         PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG556   AACCGAAC        PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451    ACCGAACC       PPDB Motif  PLACE Motif 
 AtREG456     CCGAACCG      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG423      CGAACCGG     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG528       GAACCGGT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436         ACCGGTTT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG496          CCGGTTTG PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTTCCGGT-1023626910236276-745-752
 AtREG644TTTCCGGT PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA8+10236225AT4G18590.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCTCCTCT+1023621310236223AT4G18590.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGCTGACGTGTCT+1023612010236131AT4G18590.1
 AtREG515GCTGACGT    SA PPDB MotifACGT  PLACE MotifACGT 
 AtREG440 CTGACGTG   ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG517  TGACGTGT  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG481   GACGTGTC ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 
 AtREG470    ACGTGTCTABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 
REGCAAACCGGTTCGGTTTAA+1023616710236184AT4G18590.1
 AtREG496CAAACCGG           PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436 AAACCGGT          PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG528   ACCGGTTC        PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG423    CCGGTTCG       PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG456     CGGTTCGG      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451      GGTTCGGT     PPDB Motif  PLACE Motif 
 AtREG556       GTTCGGTT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568        TTCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514         TCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG473          CGGTTTAA PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.