version
PlantPromoterDB promoter information of AT4G19985

Summary of Gene (AT4G19985)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G19985  TAIR      NCBI 
Gene model AT4G19985  
Description GCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: N-terminal protein myristoylation, metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: ATNSI (NUCLEAR SHUTTLE INTERACTING); N-acetyltransferase (TAIR:AT1G32070.3); Has 192 Blast hits to 192 proteins in 68 species: Archae - 6; Bacteria - 114; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 10832711-10831512)

Genome position     
from initiation codon
AT4G19985.1         
TSS from cDNA
TSS information
AT4G19985                        5'->3' (-)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G19985

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-10832094-383

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTTCTTCTTC-1083211110832122-400-411
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATAACCGGAT-1083217110832180-460-469
 AtREG548ATAACCGG   PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG621 TAACCGGA  PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG561  AACCGGAT PPDB MotifAACCG(G/A)  PLACE Motif 
REGATAACCGGAT-1083219210832201-481-490
 AtREG548ATAACCGG   PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG621 TAACCGGA  PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG561  AACCGGAT PPDB MotifAACCG(G/A)  PLACE Motif 
REGTCCGGTTAT-1083222910832237-518-526
 AtREG621TCCGGTTA  PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG548 CCGGTTAT PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
REGGAAACGAC-1083234610832353-635-642
 AtREG576GAAACGAC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.